Incidental Mutation 'R1961:Abcc1'
ID 317975
Institutional Source Beutler Lab
Gene Symbol Abcc1
Ensembl Gene ENSMUSG00000023088
Gene Name ATP-binding cassette, sub-family C member 1
Synonyms Mdrap, Mrp1, MRP, Abcc1b, Abcc1a
MMRRC Submission 039975-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R1961 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 14179317-14292743 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14214257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 191 (Y191H)
Ref Sequence ENSEMBL: ENSMUSP00000115763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100167] [ENSMUST00000130671] [ENSMUST00000133454] [ENSMUST00000134776] [ENSMUST00000144676] [ENSMUST00000154748] [ENSMUST00000147759]
AlphaFold O35379
Predicted Effect probably damaging
Transcript: ENSMUST00000100167
AA Change: Y178H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097743
Gene: ENSMUSG00000023088
AA Change: Y178H

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 7.8e-44 PFAM
AAA 670 845 4.07e-8 SMART
Pfam:ABC_membrane 971 1243 3e-52 PFAM
AAA 1316 1501 5.8e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130671
AA Change: Y178H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116714
Gene: ENSMUSG00000023088
AA Change: Y178H

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000133454
AA Change: Y178H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122656
Gene: ENSMUSG00000023088
AA Change: Y178H

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134776
SMART Domains Protein: ENSMUSP00000120933
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 131 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144074
Predicted Effect probably benign
Transcript: ENSMUST00000144676
SMART Domains Protein: ENSMUSP00000116726
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 63 80 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154748
AA Change: Y191H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115763
Gene: ENSMUSG00000023088
AA Change: Y191H

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 115 137 N/A INTRINSIC
transmembrane domain 144 166 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147759
AA Change: Y178H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115627
Gene: ENSMUSG00000023088
AA Change: Y178H

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Meta Mutation Damage Score 0.3102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein plays an essential role in the defense against toxic compounds and serves as the major high-affinity transporter of leukotriene C4. The encoded protein may also play an essential role in steroid hormone homeostasis as a transporter for steroid hormones and their metabolites. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have a reduced response to inflammatory stimulus, increased levels of glutathione due to impaired metabolism, and are hypersensitive to the anticancer drug etoposide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 C A 14: 118,848,871 (GRCm39) V494L possibly damaging Het
Abcc4 C A 14: 118,848,868 (GRCm39) G495C probably damaging Het
Acsm4 T C 7: 119,307,963 (GRCm39) Y367H probably benign Het
Adam21 A T 12: 81,606,282 (GRCm39) Y493* probably null Het
Add2 T C 6: 86,073,738 (GRCm39) F209S probably damaging Het
Adgre4 T C 17: 56,098,497 (GRCm39) S136P probably benign Het
Aff4 T G 11: 53,263,826 (GRCm39) L282R probably damaging Het
Akt3 A G 1: 176,924,561 (GRCm39) I178T probably damaging Het
Ap3m1 T C 14: 21,091,083 (GRCm39) Y174C probably damaging Het
Arb2a C A 13: 78,050,839 (GRCm39) H50N probably benign Het
Atl1 A G 12: 70,000,274 (GRCm39) E308G probably benign Het
Atp8b5 T G 4: 43,369,688 (GRCm39) V942G probably damaging Het
B3gntl1 A G 11: 121,535,351 (GRCm39) probably null Het
Btrc T G 19: 45,515,782 (GRCm39) I480S probably damaging Het
Cacna1c A T 6: 118,607,283 (GRCm39) I1366N probably benign Het
Ccdc113 T A 8: 96,267,459 (GRCm39) N141K probably benign Het
Ccdc167 T C 17: 29,923,405 (GRCm39) N77D possibly damaging Het
Ccser1 T C 6: 61,290,630 (GRCm39) probably benign Het
Cenpe A G 3: 134,948,254 (GRCm39) E1230G probably damaging Het
Clec12a A C 6: 129,327,444 (GRCm39) T21P possibly damaging Het
Cyp26c1 T A 19: 37,675,825 (GRCm39) F230I probably damaging Het
Exog A G 9: 119,281,332 (GRCm39) E190G possibly damaging Het
Fam162b A G 10: 51,466,430 (GRCm39) W30R probably benign Het
Fndc3b G A 3: 27,510,600 (GRCm39) Q841* probably null Het
Frzb T A 2: 80,254,945 (GRCm39) Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gabrb1 G A 5: 71,857,679 (GRCm39) R43Q probably benign Het
Gm21060 A T 19: 61,285,445 (GRCm39) H21Q possibly damaging Het
Gm4825 A G 15: 85,395,245 (GRCm39) noncoding transcript Het
Gm5581 A C 6: 131,145,125 (GRCm39) noncoding transcript Het
Gm9894 T C 13: 67,912,034 (GRCm39) noncoding transcript Het
Gpr15 T A 16: 58,538,370 (GRCm39) I240L probably benign Het
Gria4 A T 9: 4,519,546 (GRCm39) probably benign Het
Grid2 T C 6: 63,885,877 (GRCm39) L91S probably damaging Het
Igsf5 A C 16: 96,179,551 (GRCm39) T215P probably damaging Het
Kif13a G A 13: 47,018,314 (GRCm39) probably benign Het
Kif21a G A 15: 90,855,051 (GRCm39) A703V probably damaging Het
Kif27 T G 13: 58,440,937 (GRCm39) R1159S probably benign Het
Kifc2 T A 15: 76,547,025 (GRCm39) L226H probably damaging Het
Klf10 T C 15: 38,296,240 (GRCm39) H435R probably damaging Het
Masp1 T C 16: 23,271,682 (GRCm39) Y623C probably damaging Het
Megf10 T A 18: 57,345,426 (GRCm39) C118S probably damaging Het
Mical3 A G 6: 120,959,568 (GRCm39) V909A possibly damaging Het
Mmrn2 A G 14: 34,120,432 (GRCm39) probably null Het
Mpeg1 G A 19: 12,440,275 (GRCm39) V578M probably damaging Het
Nlrp2 T C 7: 5,330,737 (GRCm39) E553G probably damaging Het
Nmi A T 2: 51,838,632 (GRCm39) S301T probably benign Het
Nr2f2 G T 7: 70,007,903 (GRCm39) T193K possibly damaging Het
Ntng2 T C 2: 29,087,110 (GRCm39) N404S probably damaging Het
Nup50l A G 6: 96,142,250 (GRCm39) S265P possibly damaging Het
Oplah G A 15: 76,181,664 (GRCm39) T1119I probably damaging Het
Or1x2 T G 11: 50,918,302 (GRCm39) S158A probably benign Het
Or52e3 T C 7: 102,869,204 (GRCm39) V93A probably benign Het
Otoa T A 7: 120,717,792 (GRCm39) D336E probably benign Het
Pde4b A G 4: 102,454,657 (GRCm39) E108G probably damaging Het
Pdgfrb G A 18: 61,194,577 (GRCm39) R118H possibly damaging Het
Phactr4 G A 4: 132,104,559 (GRCm39) T256I probably benign Het
Pla2g3 C T 11: 3,440,983 (GRCm39) T316I probably benign Het
Plekhg4 A G 8: 106,108,096 (GRCm39) E982G probably damaging Het
Pmfbp1 T G 8: 110,256,776 (GRCm39) probably benign Het
Pot1b A T 17: 55,969,531 (GRCm39) Y546N probably damaging Het
Pphln1-ps1 T A 16: 13,495,592 (GRCm39) H230Q probably benign Het
Rab11fip5 C A 6: 85,325,973 (GRCm39) Q144H possibly damaging Het
Reep3 A T 10: 66,875,278 (GRCm39) probably null Het
Rgl2 T C 17: 34,152,589 (GRCm39) L400P probably damaging Het
Rnf122 A G 8: 31,614,874 (GRCm39) probably benign Het
Scgb1b21 G T 7: 33,226,803 (GRCm39) noncoding transcript Het
Sec63 A T 10: 42,699,882 (GRCm39) K647N probably damaging Het
Sema4a C T 3: 88,345,483 (GRCm39) probably benign Het
Serpinf1 C T 11: 75,307,245 (GRCm39) V31I probably benign Het
Sez6l C T 5: 112,572,481 (GRCm39) probably benign Het
Shank3 T C 15: 89,442,167 (GRCm39) S1612P possibly damaging Het
Slc19a3 G A 1: 83,000,519 (GRCm39) T166M probably benign Het
Slc22a29 C A 19: 8,146,557 (GRCm39) R415M probably benign Het
Slc38a11 A T 2: 65,160,683 (GRCm39) F304I possibly damaging Het
Slitrk1 T A 14: 109,149,622 (GRCm39) N363I probably damaging Het
Slx4ip A G 2: 136,909,601 (GRCm39) T129A probably benign Het
Spop T C 11: 95,382,537 (GRCm39) V332A possibly damaging Het
Sptlc1 A C 13: 53,512,916 (GRCm39) D147E probably benign Het
Tnpo1 T C 13: 98,989,440 (GRCm39) Y754C probably damaging Het
Tox C A 4: 6,688,886 (GRCm39) V493L probably damaging Het
Ttbk1 A C 17: 46,791,150 (GRCm39) F45V probably damaging Het
Ttc27 T A 17: 75,087,851 (GRCm39) M472K probably damaging Het
Ttll7 A G 3: 146,621,550 (GRCm39) probably benign Het
Ttn A T 2: 76,552,104 (GRCm39) C22851S probably benign Het
Ttn T A 2: 76,628,556 (GRCm39) M14535L possibly damaging Het
Txlna T C 4: 129,534,055 (GRCm39) T54A probably benign Het
Usp33 T C 3: 152,086,265 (GRCm39) V668A probably damaging Het
Vmn2r28 C A 7: 5,484,070 (GRCm39) C710F possibly damaging Het
Vmn2r8 T A 5: 108,945,961 (GRCm39) M549L probably benign Het
Vwa5b2 T C 16: 20,420,941 (GRCm39) probably null Het
Wnk1 T C 6: 119,946,208 (GRCm39) I648M probably damaging Het
Other mutations in Abcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abcc1 APN 16 14,278,847 (GRCm39) missense probably benign 0.34
IGL00094:Abcc1 APN 16 14,288,398 (GRCm39) missense probably null 0.00
IGL00475:Abcc1 APN 16 14,254,437 (GRCm39) missense probably damaging 1.00
IGL00516:Abcc1 APN 16 14,231,176 (GRCm39) nonsense probably null
IGL00765:Abcc1 APN 16 14,229,372 (GRCm39) missense probably damaging 0.99
IGL00792:Abcc1 APN 16 14,228,790 (GRCm39) missense probably benign 0.18
IGL01678:Abcc1 APN 16 14,222,883 (GRCm39) missense probably null 0.96
IGL01683:Abcc1 APN 16 14,214,288 (GRCm39) missense probably damaging 1.00
IGL01955:Abcc1 APN 16 14,228,659 (GRCm39) missense probably damaging 1.00
IGL02048:Abcc1 APN 16 14,229,383 (GRCm39) missense probably damaging 0.98
IGL02345:Abcc1 APN 16 14,214,215 (GRCm39) missense possibly damaging 0.95
IGL02366:Abcc1 APN 16 14,285,843 (GRCm39) splice site probably benign
IGL02431:Abcc1 APN 16 14,237,598 (GRCm39) missense probably damaging 1.00
IGL02480:Abcc1 APN 16 14,221,869 (GRCm39) missense possibly damaging 0.87
IGL02651:Abcc1 APN 16 14,283,990 (GRCm39) missense probably benign 0.00
IGL02902:Abcc1 APN 16 14,240,991 (GRCm39) missense probably damaging 1.00
IGL03101:Abcc1 APN 16 14,207,732 (GRCm39) missense probably damaging 1.00
IGL03230:Abcc1 APN 16 14,275,811 (GRCm39) missense probably benign
IGL03308:Abcc1 APN 16 14,288,475 (GRCm39) missense possibly damaging 0.55
gloom UTSW 16 14,229,480 (GRCm39) missense probably damaging 1.00
loom UTSW 16 14,290,794 (GRCm39) missense probably damaging 0.96
PIT4544001:Abcc1 UTSW 16 14,222,943 (GRCm39) missense probably damaging 1.00
R0310:Abcc1 UTSW 16 14,228,791 (GRCm39) missense probably damaging 0.98
R0594:Abcc1 UTSW 16 14,207,744 (GRCm39) missense probably benign 0.05
R0894:Abcc1 UTSW 16 14,283,001 (GRCm39) missense possibly damaging 0.64
R0928:Abcc1 UTSW 16 14,207,849 (GRCm39) critical splice donor site probably null
R1367:Abcc1 UTSW 16 14,261,250 (GRCm39) missense probably damaging 1.00
R1496:Abcc1 UTSW 16 14,266,298 (GRCm39) missense probably damaging 1.00
R1643:Abcc1 UTSW 16 14,231,232 (GRCm39) missense probably damaging 1.00
R1795:Abcc1 UTSW 16 14,283,001 (GRCm39) missense possibly damaging 0.64
R1834:Abcc1 UTSW 16 14,240,981 (GRCm39) missense possibly damaging 0.88
R1847:Abcc1 UTSW 16 14,263,313 (GRCm39) missense probably benign 0.02
R1959:Abcc1 UTSW 16 14,214,257 (GRCm39) missense probably damaging 1.00
R2017:Abcc1 UTSW 16 14,279,068 (GRCm39) missense probably damaging 1.00
R2224:Abcc1 UTSW 16 14,289,932 (GRCm39) missense probably damaging 1.00
R2377:Abcc1 UTSW 16 14,285,787 (GRCm39) missense probably damaging 0.97
R2513:Abcc1 UTSW 16 14,290,873 (GRCm39) splice site probably null
R2876:Abcc1 UTSW 16 14,275,824 (GRCm39) missense probably benign
R3003:Abcc1 UTSW 16 14,254,393 (GRCm39) missense probably damaging 1.00
R3941:Abcc1 UTSW 16 14,214,263 (GRCm39) missense probably benign 0.00
R4119:Abcc1 UTSW 16 14,211,877 (GRCm39) missense probably benign 0.43
R4191:Abcc1 UTSW 16 14,207,728 (GRCm39) missense probably damaging 1.00
R4369:Abcc1 UTSW 16 14,278,857 (GRCm39) missense possibly damaging 0.88
R4428:Abcc1 UTSW 16 14,263,164 (GRCm39) missense probably damaging 0.97
R4589:Abcc1 UTSW 16 14,211,895 (GRCm39) missense probably benign 0.00
R4779:Abcc1 UTSW 16 14,228,635 (GRCm39) missense probably benign 0.35
R5027:Abcc1 UTSW 16 14,221,917 (GRCm39) critical splice donor site probably null
R5275:Abcc1 UTSW 16 14,284,050 (GRCm39) missense probably damaging 1.00
R5418:Abcc1 UTSW 16 14,278,996 (GRCm39) missense probably benign 0.02
R5490:Abcc1 UTSW 16 14,228,781 (GRCm39) missense probably damaging 1.00
R5527:Abcc1 UTSW 16 14,278,842 (GRCm39) missense probably benign 0.18
R5641:Abcc1 UTSW 16 14,289,877 (GRCm39) missense probably benign 0.00
R5642:Abcc1 UTSW 16 14,261,319 (GRCm39) missense probably damaging 1.00
R5875:Abcc1 UTSW 16 14,284,901 (GRCm39) missense possibly damaging 0.94
R5916:Abcc1 UTSW 16 14,283,006 (GRCm39) missense possibly damaging 0.95
R6112:Abcc1 UTSW 16 14,278,780 (GRCm39) missense probably damaging 1.00
R6331:Abcc1 UTSW 16 14,282,920 (GRCm39) missense probably damaging 0.97
R6464:Abcc1 UTSW 16 14,265,354 (GRCm39) missense probably damaging 1.00
R6950:Abcc1 UTSW 16 14,229,480 (GRCm39) missense probably damaging 1.00
R7024:Abcc1 UTSW 16 14,231,247 (GRCm39) critical splice donor site probably null
R7115:Abcc1 UTSW 16 14,255,589 (GRCm39) missense probably benign 0.11
R7187:Abcc1 UTSW 16 14,284,861 (GRCm39) missense probably benign
R7298:Abcc1 UTSW 16 14,214,336 (GRCm39) missense possibly damaging 0.89
R7342:Abcc1 UTSW 16 14,283,033 (GRCm39) missense probably damaging 0.99
R7474:Abcc1 UTSW 16 14,290,850 (GRCm39) missense possibly damaging 0.95
R7488:Abcc1 UTSW 16 14,207,763 (GRCm39) nonsense probably null
R7583:Abcc1 UTSW 16 14,221,902 (GRCm39) missense probably damaging 1.00
R7619:Abcc1 UTSW 16 14,263,283 (GRCm39) missense probably damaging 0.96
R7971:Abcc1 UTSW 16 14,266,443 (GRCm39) missense probably benign
R8048:Abcc1 UTSW 16 14,228,708 (GRCm39) missense probably damaging 1.00
R8138:Abcc1 UTSW 16 14,290,751 (GRCm39) missense probably damaging 0.99
R8159:Abcc1 UTSW 16 14,290,794 (GRCm39) missense probably damaging 0.96
R8319:Abcc1 UTSW 16 14,214,315 (GRCm39) missense probably damaging 1.00
R8859:Abcc1 UTSW 16 14,214,225 (GRCm39) missense probably benign 0.00
R8980:Abcc1 UTSW 16 14,278,961 (GRCm39) missense probably damaging 0.99
R9480:Abcc1 UTSW 16 14,211,889 (GRCm39) missense probably damaging 1.00
R9519:Abcc1 UTSW 16 14,207,681 (GRCm39) missense probably benign
R9653:Abcc1 UTSW 16 14,214,257 (GRCm39) missense probably damaging 1.00
R9708:Abcc1 UTSW 16 14,254,417 (GRCm39) missense probably damaging 1.00
R9725:Abcc1 UTSW 16 14,290,797 (GRCm39) missense possibly damaging 0.52
R9786:Abcc1 UTSW 16 14,222,927 (GRCm39) missense probably damaging 1.00
X0026:Abcc1 UTSW 16 14,277,766 (GRCm39) missense possibly damaging 0.94
Z1088:Abcc1 UTSW 16 14,228,673 (GRCm39) missense probably benign 0.01
Z1177:Abcc1 UTSW 16 14,229,357 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATCTCATGCCATTTTGGG -3'
(R):5'- GGAATGCAATGTGAGTCTGC -3'

Sequencing Primer
(F):5'- GGGCCCCCACCACTGAAC -3'
(R):5'- GGGGCTCAGAACAAGTACCC -3'
Posted On 2015-05-19