Mutagenetix > Incidental Mutation

Incidental Mutation 'R1961:Rgl2'

317981

Institutional Source

Beutler Lab

Gene Symbol

Rgl2

Ensembl Gene

ENSMUSG00000041354

Gene Name

ral guanine nucleotide dissociation stimulator-like 2

Synonyms

KE1.5, Rab2l, Rgt2, Rlf

MMRRC Submission

039975-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R1961 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

33929543-33937687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 33933615 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 400 (L400P)

Ref Sequence

ENSEMBL: ENSMUSP00000041082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]

AlphaFold

Q61193

PDB Structure

STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000025161

SMART Domains

Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	127	152	N/A	INTRINSIC
IG	168	292	3.45e0	SMART
IG_like	302	406	4.78e1	SMART
transmembrane domain	416	438	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000047503
AA Change: L400P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: L400P

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	31	42	N/A	INTRINSIC
low complexity region	44	63	N/A	INTRINSIC
RasGEFN	87	212	9.54e-30	SMART
RasGEF	239	514	7.15e-106	SMART
low complexity region	578	592	N/A	INTRINSIC
low complexity region	602	619	N/A	INTRINSIC
low complexity region	633	648	N/A	INTRINSIC
RA	649	736	2.05e-19	SMART
low complexity region	737	762	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172468

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173153

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173258

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173266

Predicted Effect

probably benign
Transcript: ENSMUST00000173284

SMART Domains

Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

Domain	Start	End	E-Value	Type
Blast:RasGEF	2	67	1e-35	BLAST
PDB:4JGW\|B	2	67	1e-35	PDB
SCOP:d1bkds_	2	94	3e-16	SMART
low complexity region	131	145	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	186	201	N/A	INTRINSIC
RA	202	289	2.05e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173502

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173718

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174410

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174442

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174676

Meta Mutation Damage Score

0.8719

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.4%

Validation Efficiency

99% (93/94)

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	A	G	6: 96,165,269	S265P	possibly damaging	Het
3110001I22Rik	T	A	16: 13,677,728	H230Q	probably benign	Het
Abcc1	T	C	16: 14,396,393	Y191H	probably damaging	Het
Abcc4	C	A	14: 118,611,456	G495C	probably damaging	Het
Abcc4	C	A	14: 118,611,459	V494L	possibly damaging	Het
Acsm4	T	C	7: 119,708,740	Y367H	probably benign	Het
Adam21	A	T	12: 81,559,508	Y493*	probably null	Het
Add2	T	C	6: 86,096,756	F209S	probably damaging	Het
Adgre4	T	C	17: 55,791,497	S136P	probably benign	Het
Aff4	T	G	11: 53,372,999	L282R	probably damaging	Het
Akt3	A	G	1: 177,096,995	I178T	probably damaging	Het
Ap3m1	T	C	14: 21,041,015	Y174C	probably damaging	Het
Atl1	A	G	12: 69,953,500	E308G	probably benign	Het
Atp8b5	T	G	4: 43,369,688	V942G	probably damaging	Het
B3gntl1	A	G	11: 121,644,525		probably null	Het
Btrc	T	G	19: 45,527,343	I480S	probably damaging	Het
Cacna1c	A	T	6: 118,630,322	I1366N	probably benign	Het
Ccdc113	T	A	8: 95,540,831	N141K	probably benign	Het
Ccdc167	T	C	17: 29,704,431	N77D	possibly damaging	Het
Ccser1	T	C	6: 61,313,646		probably benign	Het
Cenpe	A	G	3: 135,242,493	E1230G	probably damaging	Het
Clec12a	A	C	6: 129,350,481	T21P	possibly damaging	Het
Cyp26c1	T	A	19: 37,687,377	F230I	probably damaging	Het
Exog	A	G	9: 119,452,266	E190G	possibly damaging	Het
Fam162b	A	G	10: 51,590,334	W30R	probably benign	Het
Fam172a	C	A	13: 77,902,720	H50N	probably benign	Het
Fndc3b	G	A	3: 27,456,451	Q841*	probably null	Het
Frzb	T	A	2: 80,424,601	Y197F	probably benign	Het
G530012D18Rik	CAGAGAGA	CAGAGAGAGA	1: 85,577,224		probably null	Het
Gabrb1	G	A	5: 71,700,336	R43Q	probably benign	Het
Gm21060	A	T	19: 61,297,007	H21Q	possibly damaging	Het
Gm4825	A	G	15: 85,511,044		noncoding transcript	Het
Gm5581	A	C	6: 131,168,162		noncoding transcript	Het
Gm9894	T	C	13: 67,763,915		noncoding transcript	Het
Gpr15	T	A	16: 58,718,007	I240L	probably benign	Het
Gria4	A	T	9: 4,519,546		probably benign	Het
Grid2	T	C	6: 63,908,893	L91S	probably damaging	Het
Igsf5	A	C	16: 96,378,351	T215P	probably damaging	Het
Kif13a	G	A	13: 46,864,838		probably benign	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kif27	T	G	13: 58,293,123	R1159S	probably benign	Het
Kifc2	T	A	15: 76,662,825	L226H	probably damaging	Het
Klf10	T	C	15: 38,295,996	H435R	probably damaging	Het
Masp1	T	C	16: 23,452,932	Y623C	probably damaging	Het
Megf10	T	A	18: 57,212,354	C118S	probably damaging	Het
Mical3	A	G	6: 120,982,607	V909A	possibly damaging	Het
Mmrn2	A	G	14: 34,398,475		probably null	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Nmi	A	T	2: 51,948,620	S301T	probably benign	Het
Nr2f2	G	T	7: 70,358,155	T193K	possibly damaging	Het
Ntng2	T	C	2: 29,197,098	N404S	probably damaging	Het
Olfr54	T	G	11: 51,027,475	S158A	probably benign	Het
Olfr594	T	C	7: 103,219,997	V93A	probably benign	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Otoa	T	A	7: 121,118,569	D336E	probably benign	Het
Pde4b	A	G	4: 102,597,460	E108G	probably damaging	Het
Pdgfrb	G	A	18: 61,061,505	R118H	possibly damaging	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Pla2g3	C	T	11: 3,490,983	T316I	probably benign	Het
Plekhg4	A	G	8: 105,381,464	E982G	probably damaging	Het
Pmfbp1	T	G	8: 109,530,144		probably benign	Het
Pot1b	A	T	17: 55,662,531	Y546N	probably damaging	Het
Rab11fip5	C	A	6: 85,348,991	Q144H	possibly damaging	Het
Reep3	A	T	10: 67,039,499		probably null	Het
Rnf122	A	G	8: 31,124,846		probably benign	Het
Scgb1b21	G	T	7: 33,527,378		noncoding transcript	Het
Sec63	A	T	10: 42,823,886	K647N	probably damaging	Het
Sema4a	C	T	3: 88,438,176		probably benign	Het
Serpinf1	C	T	11: 75,416,419	V31I	probably benign	Het
Sez6l	C	T	5: 112,424,615		probably benign	Het
Shank3	T	C	15: 89,557,964	S1612P	possibly damaging	Het
Slc19a3	G	A	1: 83,022,798	T166M	probably benign	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc38a11	A	T	2: 65,330,339	F304I	possibly damaging	Het
Slitrk1	T	A	14: 108,912,190	N363I	probably damaging	Het
Slx4ip	A	G	2: 137,067,681	T129A	probably benign	Het
Spop	T	C	11: 95,491,711	V332A	possibly damaging	Het
Sptlc1	A	C	13: 53,358,880	D147E	probably benign	Het
Tnpo1	T	C	13: 98,852,932	Y754C	probably damaging	Het
Tox	C	A	4: 6,688,886	V493L	probably damaging	Het
Ttbk1	A	C	17: 46,480,224	F45V	probably damaging	Het
Ttc27	T	A	17: 74,780,856	M472K	probably damaging	Het
Ttll7	A	G	3: 146,915,795		probably benign	Het
Ttn	A	T	2: 76,721,760	C22851S	probably benign	Het
Ttn	T	A	2: 76,798,212	M14535L	possibly damaging	Het
Txlna	T	C	4: 129,640,262	T54A	probably benign	Het
Usp33	T	C	3: 152,380,628	V668A	probably damaging	Het
Vmn2r28	C	A	7: 5,481,071	C710F	possibly damaging	Het
Vmn2r8	T	A	5: 108,798,095	M549L	probably benign	Het
Vwa5b2	T	C	16: 20,602,191		probably null	Het
Wnk1	T	C	6: 119,969,247	I648M	probably damaging	Het

Other mutations in Rgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Rgl2	APN	17	33933136	missense	probably benign	0.31
IGL00898:Rgl2	APN	17	33933418	missense	possibly damaging	0.95
IGL00965:Rgl2	APN	17	33935936	missense	probably benign	0.00
IGL00985:Rgl2	APN	17	33932101	missense	probably damaging	1.00
IGL02140:Rgl2	APN	17	33933124	missense	probably damaging	1.00
IGL02214:Rgl2	APN	17	33935189	missense	probably benign	0.06
IGL02486:Rgl2	APN	17	33935980	missense	probably damaging	0.97
IGL02579:Rgl2	APN	17	33937160	missense	probably benign	0.08
IGL02976:Rgl2	APN	17	33933962	missense	possibly damaging	0.95
Hypotenuse	UTSW	17	33931739	missense	probably benign	0.00
Pedernales	UTSW	17	33932038	critical splice acceptor site	probably null
PIT4354001:Rgl2	UTSW	17	33933940	missense	possibly damaging	0.80
R0347:Rgl2	UTSW	17	33932738	missense	probably damaging	1.00
R0456:Rgl2	UTSW	17	33936849	splice site	probably null
R0825:Rgl2	UTSW	17	33935159	splice site	probably null
R1742:Rgl2	UTSW	17	33937223	splice site	probably null
R1777:Rgl2	UTSW	17	33931744	missense	probably benign	0.00
R1829:Rgl2	UTSW	17	33933621	missense	probably benign	0.00
R1908:Rgl2	UTSW	17	33932148	missense	probably benign	0.00
R2102:Rgl2	UTSW	17	33933340	splice site	probably null
R3001:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3002:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3755:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3756:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3978:Rgl2	UTSW	17	33935162	missense	probably benign	0.02
R4042:Rgl2	UTSW	17	33937262	missense	probably damaging	1.00
R4064:Rgl2	UTSW	17	33937108	missense	possibly damaging	0.77
R4204:Rgl2	UTSW	17	33936932	missense	probably benign	0.04
R4661:Rgl2	UTSW	17	33933226	missense	possibly damaging	0.77
R4852:Rgl2	UTSW	17	33937173	missense	probably benign	0.00
R4922:Rgl2	UTSW	17	33932775	unclassified	probably benign
R5119:Rgl2	UTSW	17	33937120	missense	probably benign	0.00
R5167:Rgl2	UTSW	17	33935974	nonsense	probably null
R5279:Rgl2	UTSW	17	33935948	missense	probably benign
R5319:Rgl2	UTSW	17	33933555	missense	probably benign	0.02
R5337:Rgl2	UTSW	17	33934984	missense	probably damaging	0.99
R5881:Rgl2	UTSW	17	33932717	missense	probably benign	0.01
R5945:Rgl2	UTSW	17	33932038	critical splice acceptor site	probably null
R6165:Rgl2	UTSW	17	33931765	missense	probably benign	0.01
R6358:Rgl2	UTSW	17	33937131	splice site	probably null
R6867:Rgl2	UTSW	17	33932687	missense	probably benign	0.09
R7174:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7182:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7183:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7184:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7196:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7203:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7250:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7253:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7254:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7255:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7256:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7282:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7455:Rgl2	UTSW	17	33932683	missense	probably benign	0.32
R7513:Rgl2	UTSW	17	33932555	missense	probably benign
R7752:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7901:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7941:Rgl2	UTSW	17	33931739	missense	probably benign	0.00
R8158:Rgl2	UTSW	17	33936944	missense	probably benign	0.27
R8209:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8226:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8405:Rgl2	UTSW	17	33933724	nonsense	probably null
R8871:Rgl2	UTSW	17	33935000	missense	probably damaging	1.00
R9205:Rgl2	UTSW	17	33936028	missense	probably damaging	1.00
R9591:Rgl2	UTSW	17	33932477	missense	possibly damaging	0.50
X0028:Rgl2	UTSW	17	33932458	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GGAACTTCTCCTCAGTGTATGC -3'
(R):5'- ATTCTCCTCACCAGGTAAGCC -3'

Sequencing Primer
(F):5'- TATCCACAGGCTTCGGGCAG -3'
(R):5'- GGTAAGCCACCCATTCCCAG -3'

Posted On

2015-05-19