Incidental Mutation 'R1961:Pdgfrb'
ID 317987
Institutional Source Beutler Lab
Gene Symbol Pdgfrb
Ensembl Gene ENSMUSG00000024620
Gene Name platelet derived growth factor receptor, beta polypeptide
Synonyms CD140b, Pdgfr
MMRRC Submission 039975-MU
Accession Numbers

Ncbi RefSeq: NM_001146268.1, NM_008809.2; MGI:97531
Essential gene? Essential (E-score: 1.000) question?
Stock # R1961 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 61045150-61085061 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 61061505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 118 (R118H)
Ref Sequence ENSEMBL: ENSMUSP00000110929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025522] [ENSMUST00000115274]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000025522
AA Change: R114H

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025522
Gene: ENSMUSG00000024620
AA Change: R114H

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
IG 38 120 5.58e-2 SMART
IGc2 225 297 2.83e-12 SMART
IG_like 330 402 1.47e0 SMART
Pfam:Ig_2 415 524 5.6e-2 PFAM
transmembrane domain 534 556 N/A INTRINSIC
TyrKc 600 958 1.11e-135 SMART
low complexity region 1063 1083 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115274
AA Change: R118H

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110929
Gene: ENSMUSG00000024620
AA Change: R118H

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 42 124 5.58e-2 SMART
IGc2 229 301 2.83e-12 SMART
IG_like 334 406 1.47e0 SMART
transmembrane domain 538 560 N/A INTRINSIC
TyrKc 604 962 1.11e-135 SMART
low complexity region 1067 1087 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype Strain: 2682393; 2135508
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die perinatally with internal bleeding, thrombocytopenia, anemia and kidney defects. A frameshift mutation results in neonatal lethals with edema and hemorrhaging; several point mutations show cardiovascular abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(23) Gene trapped(2)
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
3110001I22Rik T A 16: 13,677,728 H230Q probably benign Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Abcc4 C A 14: 118,611,456 G495C probably damaging Het
Abcc4 C A 14: 118,611,459 V494L possibly damaging Het
Acsm4 T C 7: 119,708,740 Y367H probably benign Het
Adam21 A T 12: 81,559,508 Y493* probably null Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Aff4 T G 11: 53,372,999 L282R probably damaging Het
Akt3 A G 1: 177,096,995 I178T probably damaging Het
Ap3m1 T C 14: 21,041,015 Y174C probably damaging Het
Atl1 A G 12: 69,953,500 E308G probably benign Het
Atp8b5 T G 4: 43,369,688 V942G probably damaging Het
B3gntl1 A G 11: 121,644,525 probably null Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cacna1c A T 6: 118,630,322 I1366N probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc167 T C 17: 29,704,431 N77D possibly damaging Het
Ccser1 T C 6: 61,313,646 probably benign Het
Cenpe A G 3: 135,242,493 E1230G probably damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Exog A G 9: 119,452,266 E190G possibly damaging Het
Fam162b A G 10: 51,590,334 W30R probably benign Het
Fam172a C A 13: 77,902,720 H50N probably benign Het
Fndc3b G A 3: 27,456,451 Q841* probably null Het
Frzb T A 2: 80,424,601 Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 G A 5: 71,700,336 R43Q probably benign Het
Gm21060 A T 19: 61,297,007 H21Q possibly damaging Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Gm5581 A C 6: 131,168,162 noncoding transcript Het
Gm9894 T C 13: 67,763,915 noncoding transcript Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Gria4 A T 9: 4,519,546 probably benign Het
Grid2 T C 6: 63,908,893 L91S probably damaging Het
Igsf5 A C 16: 96,378,351 T215P probably damaging Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Kifc2 T A 15: 76,662,825 L226H probably damaging Het
Klf10 T C 15: 38,295,996 H435R probably damaging Het
Masp1 T C 16: 23,452,932 Y623C probably damaging Het
Megf10 T A 18: 57,212,354 C118S probably damaging Het
Mical3 A G 6: 120,982,607 V909A possibly damaging Het
Mmrn2 A G 14: 34,398,475 probably null Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nmi A T 2: 51,948,620 S301T probably benign Het
Nr2f2 G T 7: 70,358,155 T193K possibly damaging Het
Ntng2 T C 2: 29,197,098 N404S probably damaging Het
Olfr54 T G 11: 51,027,475 S158A probably benign Het
Olfr594 T C 7: 103,219,997 V93A probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Otoa T A 7: 121,118,569 D336E probably benign Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Plekhg4 A G 8: 105,381,464 E982G probably damaging Het
Pmfbp1 T G 8: 109,530,144 probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rab11fip5 C A 6: 85,348,991 Q144H possibly damaging Het
Reep3 A T 10: 67,039,499 probably null Het
Rgl2 T C 17: 33,933,615 L400P probably damaging Het
Rnf122 A G 8: 31,124,846 probably benign Het
Scgb1b21 G T 7: 33,527,378 noncoding transcript Het
Sec63 A T 10: 42,823,886 K647N probably damaging Het
Sema4a C T 3: 88,438,176 probably benign Het
Serpinf1 C T 11: 75,416,419 V31I probably benign Het
Sez6l C T 5: 112,424,615 probably benign Het
Shank3 T C 15: 89,557,964 S1612P possibly damaging Het
Slc19a3 G A 1: 83,022,798 T166M probably benign Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc38a11 A T 2: 65,330,339 F304I possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Slx4ip A G 2: 137,067,681 T129A probably benign Het
Spop T C 11: 95,491,711 V332A possibly damaging Het
Sptlc1 A C 13: 53,358,880 D147E probably benign Het
Tnpo1 T C 13: 98,852,932 Y754C probably damaging Het
Tox C A 4: 6,688,886 V493L probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttc27 T A 17: 74,780,856 M472K probably damaging Het
Ttll7 A G 3: 146,915,795 probably benign Het
Ttn A T 2: 76,721,760 C22851S probably benign Het
Ttn T A 2: 76,798,212 M14535L possibly damaging Het
Txlna T C 4: 129,640,262 T54A probably benign Het
Usp33 T C 3: 152,380,628 V668A probably damaging Het
Vmn2r28 C A 7: 5,481,071 C710F possibly damaging Het
Vmn2r8 T A 5: 108,798,095 M549L probably benign Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Other mutations in Pdgfrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Pdgfrb APN 18 61068936 missense probably benign 0.20
IGL01396:Pdgfrb APN 18 61072664 missense probably damaging 1.00
IGL02377:Pdgfrb APN 18 61080332 missense probably damaging 1.00
IGL02435:Pdgfrb APN 18 61064926 critical splice donor site probably null
IGL03397:Pdgfrb APN 18 61079681 missense probably benign 0.28
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0087:Pdgfrb UTSW 18 61061513 missense probably damaging 1.00
R0119:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0299:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0532:Pdgfrb UTSW 18 61083265 missense probably damaging 1.00
R0570:Pdgfrb UTSW 18 61077703 missense probably benign 0.00
R0629:Pdgfrb UTSW 18 61078648 critical splice donor site probably null
R0650:Pdgfrb UTSW 18 61079708 missense probably benign 0.00
R0853:Pdgfrb UTSW 18 61080327 missense probably damaging 1.00
R1165:Pdgfrb UTSW 18 61064002 missense probably benign 0.01
R1342:Pdgfrb UTSW 18 61065880 nonsense probably null
R1740:Pdgfrb UTSW 18 61081833 missense possibly damaging 0.93
R1808:Pdgfrb UTSW 18 61068102 missense probably benign
R1864:Pdgfrb UTSW 18 61071717 missense probably benign 0.00
R1960:Pdgfrb UTSW 18 61065783 missense probably benign 0.05
R1970:Pdgfrb UTSW 18 61066494 splice site probably benign
R2011:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2012:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2018:Pdgfrb UTSW 18 61083334 missense possibly damaging 0.84
R2153:Pdgfrb UTSW 18 61072756 missense probably damaging 1.00
R2497:Pdgfrb UTSW 18 61078628 missense possibly damaging 0.58
R2846:Pdgfrb UTSW 18 61064016 missense probably benign 0.00
R3776:Pdgfrb UTSW 18 61081920 missense probably benign 0.00
R3779:Pdgfrb UTSW 18 61072666 missense probably damaging 1.00
R3816:Pdgfrb UTSW 18 61078945 missense probably damaging 1.00
R3978:Pdgfrb UTSW 18 61073685 missense probably damaging 1.00
R4259:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4261:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4327:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4329:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4598:Pdgfrb UTSW 18 61068757 missense probably benign 0.03
R4668:Pdgfrb UTSW 18 61064113 missense probably damaging 1.00
R4761:Pdgfrb UTSW 18 61079700 missense probably damaging 1.00
R4787:Pdgfrb UTSW 18 61079687 missense probably damaging 1.00
R4828:Pdgfrb UTSW 18 61073243 missense probably damaging 0.98
R5030:Pdgfrb UTSW 18 61065135 missense probably benign 0.13
R5033:Pdgfrb UTSW 18 61077668 missense probably damaging 1.00
R5447:Pdgfrb UTSW 18 61068108 missense probably damaging 1.00
R6224:Pdgfrb UTSW 18 61081939 nonsense probably null
R6807:Pdgfrb UTSW 18 61078649 critical splice donor site probably null
R6858:Pdgfrb UTSW 18 61065147 missense probably benign 0.01
R7017:Pdgfrb UTSW 18 61081004 missense probably benign 0.00
R7089:Pdgfrb UTSW 18 61073243 missense probably damaging 1.00
R7174:Pdgfrb UTSW 18 61066515 missense probably benign
R7374:Pdgfrb UTSW 18 61071708 missense possibly damaging 0.64
R7496:Pdgfrb UTSW 18 61078932 missense possibly damaging 0.71
R7565:Pdgfrb UTSW 18 61083264 missense probably damaging 1.00
R7615:Pdgfrb UTSW 18 61064046 missense probably benign 0.00
R7691:Pdgfrb UTSW 18 61061268 missense probably benign 0.05
R7884:Pdgfrb UTSW 18 61072658 missense probably damaging 1.00
R8481:Pdgfrb UTSW 18 61065742 missense probably benign 0.03
R8735:Pdgfrb UTSW 18 61063977 missense probably benign 0.26
R8737:Pdgfrb UTSW 18 61081001 missense probably damaging 1.00
R9067:Pdgfrb UTSW 18 61068219 missense probably null 0.93
R9106:Pdgfrb UTSW 18 61046028 critical splice acceptor site probably null
R9161:Pdgfrb UTSW 18 61063981 missense probably damaging 1.00
R9234:Pdgfrb UTSW 18 61061228 missense probably null 0.00
R9380:Pdgfrb UTSW 18 61064848 missense probably damaging 1.00
R9452:Pdgfrb UTSW 18 61065726 missense possibly damaging 0.77
R9491:Pdgfrb UTSW 18 61078984 missense probably damaging 1.00
R9646:Pdgfrb UTSW 18 61078649 critical splice donor site probably null
R9717:Pdgfrb UTSW 18 61072715 nonsense probably null
X0060:Pdgfrb UTSW 18 61081976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTTGTTCTCAACATCTCCAGC -3'
(R):5'- TGGAAAGAGCATGCTCCTGG -3'

Sequencing Primer
(F):5'- TGTTCTGACCTGCTCGGGC -3'
(R):5'- AGAGCATGCTCCTGGACTGAG -3'
Posted On 2015-05-19