Incidental Mutation 'R1961:Pdgfrb'
ID 317987
Institutional Source Beutler Lab
Gene Symbol Pdgfrb
Ensembl Gene ENSMUSG00000024620
Gene Name platelet derived growth factor receptor, beta polypeptide
Synonyms CD140b, Pdgfr
MMRRC Submission 039975-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1961 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 61178222-61218133 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 61194577 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 118 (R118H)
Ref Sequence ENSEMBL: ENSMUSP00000110929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025522] [ENSMUST00000115274]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000025522
AA Change: R114H

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025522
Gene: ENSMUSG00000024620
AA Change: R114H

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
IG 38 120 5.58e-2 SMART
IGc2 225 297 2.83e-12 SMART
IG_like 330 402 1.47e0 SMART
Pfam:Ig_2 415 524 5.6e-2 PFAM
transmembrane domain 534 556 N/A INTRINSIC
TyrKc 600 958 1.11e-135 SMART
low complexity region 1063 1083 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115274
AA Change: R118H

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110929
Gene: ENSMUSG00000024620
AA Change: R118H

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 42 124 5.58e-2 SMART
IGc2 229 301 2.83e-12 SMART
IG_like 334 406 1.47e0 SMART
transmembrane domain 538 560 N/A INTRINSIC
TyrKc 604 962 1.11e-135 SMART
low complexity region 1067 1087 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die perinatally with internal bleeding, thrombocytopenia, anemia and kidney defects. A frameshift mutation results in neonatal lethals with edema and hemorrhaging; several point mutations show cardiovascular abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(23) Gene trapped(2)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T C 16: 14,214,257 (GRCm39) Y191H probably damaging Het
Abcc4 C A 14: 118,848,871 (GRCm39) V494L possibly damaging Het
Abcc4 C A 14: 118,848,868 (GRCm39) G495C probably damaging Het
Acsm4 T C 7: 119,307,963 (GRCm39) Y367H probably benign Het
Adam21 A T 12: 81,606,282 (GRCm39) Y493* probably null Het
Add2 T C 6: 86,073,738 (GRCm39) F209S probably damaging Het
Adgre4 T C 17: 56,098,497 (GRCm39) S136P probably benign Het
Aff4 T G 11: 53,263,826 (GRCm39) L282R probably damaging Het
Akt3 A G 1: 176,924,561 (GRCm39) I178T probably damaging Het
Ap3m1 T C 14: 21,091,083 (GRCm39) Y174C probably damaging Het
Arb2a C A 13: 78,050,839 (GRCm39) H50N probably benign Het
Atl1 A G 12: 70,000,274 (GRCm39) E308G probably benign Het
Atp8b5 T G 4: 43,369,688 (GRCm39) V942G probably damaging Het
B3gntl1 A G 11: 121,535,351 (GRCm39) probably null Het
Btrc T G 19: 45,515,782 (GRCm39) I480S probably damaging Het
Cacna1c A T 6: 118,607,283 (GRCm39) I1366N probably benign Het
Ccdc113 T A 8: 96,267,459 (GRCm39) N141K probably benign Het
Ccdc167 T C 17: 29,923,405 (GRCm39) N77D possibly damaging Het
Ccser1 T C 6: 61,290,630 (GRCm39) probably benign Het
Cenpe A G 3: 134,948,254 (GRCm39) E1230G probably damaging Het
Clec12a A C 6: 129,327,444 (GRCm39) T21P possibly damaging Het
Cyp26c1 T A 19: 37,675,825 (GRCm39) F230I probably damaging Het
Exog A G 9: 119,281,332 (GRCm39) E190G possibly damaging Het
Fam162b A G 10: 51,466,430 (GRCm39) W30R probably benign Het
Fndc3b G A 3: 27,510,600 (GRCm39) Q841* probably null Het
Frzb T A 2: 80,254,945 (GRCm39) Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,504,945 (GRCm39) probably null Het
Gabrb1 G A 5: 71,857,679 (GRCm39) R43Q probably benign Het
Gm21060 A T 19: 61,285,445 (GRCm39) H21Q possibly damaging Het
Gm4825 A G 15: 85,395,245 (GRCm39) noncoding transcript Het
Gm5581 A C 6: 131,145,125 (GRCm39) noncoding transcript Het
Gm9894 T C 13: 67,912,034 (GRCm39) noncoding transcript Het
Gpr15 T A 16: 58,538,370 (GRCm39) I240L probably benign Het
Gria4 A T 9: 4,519,546 (GRCm39) probably benign Het
Grid2 T C 6: 63,885,877 (GRCm39) L91S probably damaging Het
Igsf5 A C 16: 96,179,551 (GRCm39) T215P probably damaging Het
Kif13a G A 13: 47,018,314 (GRCm39) probably benign Het
Kif21a G A 15: 90,855,051 (GRCm39) A703V probably damaging Het
Kif27 T G 13: 58,440,937 (GRCm39) R1159S probably benign Het
Kifc2 T A 15: 76,547,025 (GRCm39) L226H probably damaging Het
Klf10 T C 15: 38,296,240 (GRCm39) H435R probably damaging Het
Masp1 T C 16: 23,271,682 (GRCm39) Y623C probably damaging Het
Megf10 T A 18: 57,345,426 (GRCm39) C118S probably damaging Het
Mical3 A G 6: 120,959,568 (GRCm39) V909A possibly damaging Het
Mmrn2 A G 14: 34,120,432 (GRCm39) probably null Het
Mpeg1 G A 19: 12,440,275 (GRCm39) V578M probably damaging Het
Nlrp2 T C 7: 5,330,737 (GRCm39) E553G probably damaging Het
Nmi A T 2: 51,838,632 (GRCm39) S301T probably benign Het
Nr2f2 G T 7: 70,007,903 (GRCm39) T193K possibly damaging Het
Ntng2 T C 2: 29,087,110 (GRCm39) N404S probably damaging Het
Nup50l A G 6: 96,142,250 (GRCm39) S265P possibly damaging Het
Oplah G A 15: 76,181,664 (GRCm39) T1119I probably damaging Het
Or1x2 T G 11: 50,918,302 (GRCm39) S158A probably benign Het
Or52e3 T C 7: 102,869,204 (GRCm39) V93A probably benign Het
Otoa T A 7: 120,717,792 (GRCm39) D336E probably benign Het
Pde4b A G 4: 102,454,657 (GRCm39) E108G probably damaging Het
Phactr4 G A 4: 132,104,559 (GRCm39) T256I probably benign Het
Pla2g3 C T 11: 3,440,983 (GRCm39) T316I probably benign Het
Plekhg4 A G 8: 106,108,096 (GRCm39) E982G probably damaging Het
Pmfbp1 T G 8: 110,256,776 (GRCm39) probably benign Het
Pot1b A T 17: 55,969,531 (GRCm39) Y546N probably damaging Het
Pphln1-ps1 T A 16: 13,495,592 (GRCm39) H230Q probably benign Het
Rab11fip5 C A 6: 85,325,973 (GRCm39) Q144H possibly damaging Het
Reep3 A T 10: 66,875,278 (GRCm39) probably null Het
Rgl2 T C 17: 34,152,589 (GRCm39) L400P probably damaging Het
Rnf122 A G 8: 31,614,874 (GRCm39) probably benign Het
Scgb1b21 G T 7: 33,226,803 (GRCm39) noncoding transcript Het
Sec63 A T 10: 42,699,882 (GRCm39) K647N probably damaging Het
Sema4a C T 3: 88,345,483 (GRCm39) probably benign Het
Serpinf1 C T 11: 75,307,245 (GRCm39) V31I probably benign Het
Sez6l C T 5: 112,572,481 (GRCm39) probably benign Het
Shank3 T C 15: 89,442,167 (GRCm39) S1612P possibly damaging Het
Slc19a3 G A 1: 83,000,519 (GRCm39) T166M probably benign Het
Slc22a29 C A 19: 8,146,557 (GRCm39) R415M probably benign Het
Slc38a11 A T 2: 65,160,683 (GRCm39) F304I possibly damaging Het
Slitrk1 T A 14: 109,149,622 (GRCm39) N363I probably damaging Het
Slx4ip A G 2: 136,909,601 (GRCm39) T129A probably benign Het
Spop T C 11: 95,382,537 (GRCm39) V332A possibly damaging Het
Sptlc1 A C 13: 53,512,916 (GRCm39) D147E probably benign Het
Tnpo1 T C 13: 98,989,440 (GRCm39) Y754C probably damaging Het
Tox C A 4: 6,688,886 (GRCm39) V493L probably damaging Het
Ttbk1 A C 17: 46,791,150 (GRCm39) F45V probably damaging Het
Ttc27 T A 17: 75,087,851 (GRCm39) M472K probably damaging Het
Ttll7 A G 3: 146,621,550 (GRCm39) probably benign Het
Ttn A T 2: 76,552,104 (GRCm39) C22851S probably benign Het
Ttn T A 2: 76,628,556 (GRCm39) M14535L possibly damaging Het
Txlna T C 4: 129,534,055 (GRCm39) T54A probably benign Het
Usp33 T C 3: 152,086,265 (GRCm39) V668A probably damaging Het
Vmn2r28 C A 7: 5,484,070 (GRCm39) C710F possibly damaging Het
Vmn2r8 T A 5: 108,945,961 (GRCm39) M549L probably benign Het
Vwa5b2 T C 16: 20,420,941 (GRCm39) probably null Het
Wnk1 T C 6: 119,946,208 (GRCm39) I648M probably damaging Het
Other mutations in Pdgfrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Pdgfrb APN 18 61,202,008 (GRCm39) missense probably benign 0.20
IGL01396:Pdgfrb APN 18 61,205,736 (GRCm39) missense probably damaging 1.00
IGL02377:Pdgfrb APN 18 61,213,404 (GRCm39) missense probably damaging 1.00
IGL02435:Pdgfrb APN 18 61,197,998 (GRCm39) critical splice donor site probably null
IGL03397:Pdgfrb APN 18 61,212,753 (GRCm39) missense probably benign 0.28
R0021:Pdgfrb UTSW 18 61,197,998 (GRCm39) critical splice donor site probably benign
R0021:Pdgfrb UTSW 18 61,197,998 (GRCm39) critical splice donor site probably benign
R0087:Pdgfrb UTSW 18 61,194,585 (GRCm39) missense probably damaging 1.00
R0119:Pdgfrb UTSW 18 61,201,924 (GRCm39) missense probably benign 0.06
R0299:Pdgfrb UTSW 18 61,201,924 (GRCm39) missense probably benign 0.06
R0532:Pdgfrb UTSW 18 61,216,337 (GRCm39) missense probably damaging 1.00
R0570:Pdgfrb UTSW 18 61,210,775 (GRCm39) missense probably benign 0.00
R0629:Pdgfrb UTSW 18 61,211,720 (GRCm39) critical splice donor site probably null
R0650:Pdgfrb UTSW 18 61,212,780 (GRCm39) missense probably benign 0.00
R0853:Pdgfrb UTSW 18 61,213,399 (GRCm39) missense probably damaging 1.00
R1165:Pdgfrb UTSW 18 61,197,074 (GRCm39) missense probably benign 0.01
R1342:Pdgfrb UTSW 18 61,198,952 (GRCm39) nonsense probably null
R1740:Pdgfrb UTSW 18 61,214,905 (GRCm39) missense possibly damaging 0.93
R1808:Pdgfrb UTSW 18 61,201,174 (GRCm39) missense probably benign
R1864:Pdgfrb UTSW 18 61,204,789 (GRCm39) missense probably benign 0.00
R1960:Pdgfrb UTSW 18 61,198,855 (GRCm39) missense probably benign 0.05
R1970:Pdgfrb UTSW 18 61,199,566 (GRCm39) splice site probably benign
R2011:Pdgfrb UTSW 18 61,194,566 (GRCm39) missense probably benign 0.01
R2012:Pdgfrb UTSW 18 61,194,566 (GRCm39) missense probably benign 0.01
R2018:Pdgfrb UTSW 18 61,216,406 (GRCm39) missense possibly damaging 0.84
R2153:Pdgfrb UTSW 18 61,205,828 (GRCm39) missense probably damaging 1.00
R2497:Pdgfrb UTSW 18 61,211,700 (GRCm39) missense possibly damaging 0.58
R2846:Pdgfrb UTSW 18 61,197,088 (GRCm39) missense probably benign 0.00
R3776:Pdgfrb UTSW 18 61,214,992 (GRCm39) missense probably benign 0.00
R3779:Pdgfrb UTSW 18 61,205,738 (GRCm39) missense probably damaging 1.00
R3816:Pdgfrb UTSW 18 61,212,017 (GRCm39) missense probably damaging 1.00
R3978:Pdgfrb UTSW 18 61,206,757 (GRCm39) missense probably damaging 1.00
R4259:Pdgfrb UTSW 18 61,210,703 (GRCm39) missense probably benign 0.00
R4261:Pdgfrb UTSW 18 61,210,703 (GRCm39) missense probably benign 0.00
R4327:Pdgfrb UTSW 18 61,204,792 (GRCm39) missense possibly damaging 0.83
R4329:Pdgfrb UTSW 18 61,204,792 (GRCm39) missense possibly damaging 0.83
R4598:Pdgfrb UTSW 18 61,201,829 (GRCm39) missense probably benign 0.03
R4668:Pdgfrb UTSW 18 61,197,185 (GRCm39) missense probably damaging 1.00
R4761:Pdgfrb UTSW 18 61,212,772 (GRCm39) missense probably damaging 1.00
R4787:Pdgfrb UTSW 18 61,212,759 (GRCm39) missense probably damaging 1.00
R4828:Pdgfrb UTSW 18 61,206,315 (GRCm39) missense probably damaging 0.98
R5030:Pdgfrb UTSW 18 61,198,207 (GRCm39) missense probably benign 0.13
R5033:Pdgfrb UTSW 18 61,210,740 (GRCm39) missense probably damaging 1.00
R5447:Pdgfrb UTSW 18 61,201,180 (GRCm39) missense probably damaging 1.00
R6224:Pdgfrb UTSW 18 61,215,011 (GRCm39) nonsense probably null
R6807:Pdgfrb UTSW 18 61,211,721 (GRCm39) critical splice donor site probably null
R6858:Pdgfrb UTSW 18 61,198,219 (GRCm39) missense probably benign 0.01
R7017:Pdgfrb UTSW 18 61,214,076 (GRCm39) missense probably benign 0.00
R7089:Pdgfrb UTSW 18 61,206,315 (GRCm39) missense probably damaging 1.00
R7174:Pdgfrb UTSW 18 61,199,587 (GRCm39) missense probably benign
R7374:Pdgfrb UTSW 18 61,204,780 (GRCm39) missense possibly damaging 0.64
R7496:Pdgfrb UTSW 18 61,212,004 (GRCm39) missense possibly damaging 0.71
R7565:Pdgfrb UTSW 18 61,216,336 (GRCm39) missense probably damaging 1.00
R7615:Pdgfrb UTSW 18 61,197,118 (GRCm39) missense probably benign 0.00
R7691:Pdgfrb UTSW 18 61,194,340 (GRCm39) missense probably benign 0.05
R7884:Pdgfrb UTSW 18 61,205,730 (GRCm39) missense probably damaging 1.00
R8481:Pdgfrb UTSW 18 61,198,814 (GRCm39) missense probably benign 0.03
R8735:Pdgfrb UTSW 18 61,197,049 (GRCm39) missense probably benign 0.26
R8737:Pdgfrb UTSW 18 61,214,073 (GRCm39) missense probably damaging 1.00
R9067:Pdgfrb UTSW 18 61,201,291 (GRCm39) missense probably null 0.93
R9106:Pdgfrb UTSW 18 61,179,100 (GRCm39) critical splice acceptor site probably null
R9161:Pdgfrb UTSW 18 61,197,053 (GRCm39) missense probably damaging 1.00
R9234:Pdgfrb UTSW 18 61,194,300 (GRCm39) missense probably null 0.00
R9380:Pdgfrb UTSW 18 61,197,920 (GRCm39) missense probably damaging 1.00
R9452:Pdgfrb UTSW 18 61,198,798 (GRCm39) missense possibly damaging 0.77
R9491:Pdgfrb UTSW 18 61,212,056 (GRCm39) missense probably damaging 1.00
R9646:Pdgfrb UTSW 18 61,211,721 (GRCm39) critical splice donor site probably null
R9717:Pdgfrb UTSW 18 61,205,787 (GRCm39) nonsense probably null
X0060:Pdgfrb UTSW 18 61,215,048 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTTGTTCTCAACATCTCCAGC -3'
(R):5'- TGGAAAGAGCATGCTCCTGG -3'

Sequencing Primer
(F):5'- TGTTCTGACCTGCTCGGGC -3'
(R):5'- AGAGCATGCTCCTGGACTGAG -3'
Posted On 2015-05-19