Incidental Mutation 'R0393:Ccr9'
ID31799
Institutional Source Beutler Lab
Gene Symbol Ccr9
Ensembl Gene ENSMUSG00000029530
Gene Namechemokine (C-C motif) receptor 9
SynonymsCmkbr10, GPR-9-6
MMRRC Submission 038599-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0393 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123678439-123784330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123779970 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 239 (H239L)
Ref Sequence ENSEMBL: ENSMUSP00000137144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111454] [ENSMUST00000163559] [ENSMUST00000166236] [ENSMUST00000168910] [ENSMUST00000180093]
Predicted Effect probably benign
Transcript: ENSMUST00000111454
AA Change: H227L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000107081
Gene: ENSMUSG00000029530
AA Change: H227L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 47 320 1.2e-5 PFAM
Pfam:7tm_1 53 305 1.1e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163559
AA Change: H239L

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131782
Gene: ENSMUSG00000029530
AA Change: H239L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166236
AA Change: H239L

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127024
Gene: ENSMUSG00000029530
AA Change: H239L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 4.6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168910
AA Change: H239L

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126758
Gene: ENSMUSG00000029530
AA Change: H239L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172093
Predicted Effect probably benign
Transcript: ENSMUST00000180093
AA Change: H239L

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000137144
Gene: ENSMUSG00000029530
AA Change: H239L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 332 5.9e-6 PFAM
Pfam:7tm_1 65 317 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214413
Meta Mutation Damage Score 0.2956 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice have altered trafficing of lymphocytes to the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,645,878 probably benign Het
Akr1b7 T G 6: 34,415,400 Y49* probably null Het
Ankrd10 G T 8: 11,635,482 R46S possibly damaging Het
Atp13a5 A G 16: 29,266,929 probably benign Het
Baz1a A G 12: 54,918,436 probably null Het
Bicd2 C T 13: 49,379,870 T644M probably damaging Het
Cd180 A T 13: 102,705,900 N485Y probably damaging Het
Ces1d T A 8: 93,192,772 S131C probably damaging Het
Cnpy2 T A 10: 128,326,207 S116R probably benign Het
Crym T C 7: 120,189,749 K285R probably benign Het
Cyp2a4 A T 7: 26,312,868 I359F possibly damaging Het
Cyp2b10 T A 7: 25,914,934 probably benign Het
Dcpp3 A T 17: 23,917,951 probably benign Het
Dnah8 T A 17: 30,708,390 I1340K probably benign Het
Fbln1 T C 15: 85,227,076 C144R probably damaging Het
Gm1553 T C 10: 82,492,176 R66G unknown Het
Il10rb G A 16: 91,412,010 V103I probably benign Het
Irak1bp1 T A 9: 82,846,561 W182R probably benign Het
Kcna3 T C 3: 107,036,999 S193P probably damaging Het
Kif14 C T 1: 136,482,418 H628Y probably damaging Het
Krt31 A G 11: 100,050,253 L77P probably damaging Het
Krt36 C T 11: 100,104,114 A211T possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lmo7 A G 14: 101,900,456 T743A probably benign Het
Lyst C T 13: 13,647,079 T1346M probably benign Het
Mapkbp1 T A 2: 120,012,903 probably null Het
Mif T C 10: 75,859,804 D55G probably benign Het
Mlh3 G T 12: 85,267,587 C608* probably null Het
Mlip A T 9: 77,239,577 C85S probably benign Het
Mug1 T C 6: 121,849,850 S211P possibly damaging Het
Mybl2 T A 2: 163,061,608 probably benign Het
Myh8 C T 11: 67,306,017 probably benign Het
Nanos1 A G 19: 60,756,930 Y222C probably damaging Het
Olfr1113 A T 2: 87,213,693 Y267F probably benign Het
Olfr1155 T C 2: 87,943,565 D21G possibly damaging Het
Olfr138 G T 17: 38,274,883 M37I probably benign Het
Papolb A G 5: 142,529,456 V144A probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Plod1 A T 4: 147,918,841 L509Q probably null Het
Ppp1r13b C A 12: 111,835,688 M290I probably benign Het
Ralb G C 1: 119,478,126 probably null Het
Slc4a8 T A 15: 100,774,638 D18E probably damaging Het
Speg A C 1: 75,423,924 H2576P possibly damaging Het
Spock1 T C 13: 57,440,536 D241G probably damaging Het
Tcam1 T A 11: 106,284,214 V165E probably benign Het
Thbs1 T A 2: 118,112,991 V30E possibly damaging Het
Tll2 A G 19: 41,088,826 Y834H possibly damaging Het
Tmem5 T C 10: 122,095,936 probably benign Het
Trpm6 G A 19: 18,778,644 D84N probably damaging Het
Ubr1 T A 2: 120,906,946 Q1039L probably damaging Het
Ubr4 A G 4: 139,410,860 probably benign Het
Vmn1r74 T C 7: 11,847,315 Y181H possibly damaging Het
Vmn2r13 T C 5: 109,156,529 T679A probably benign Het
Vmn2r91 A T 17: 18,105,450 Y110F probably damaging Het
Zbtb40 A C 4: 137,018,531 S64A probably benign Het
Zfp184 T A 13: 21,947,082 probably benign Het
Other mutations in Ccr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ccr9 APN 9 123780044 missense probably benign 0.00
IGL00983:Ccr9 APN 9 123779286 missense probably benign
IGL02466:Ccr9 APN 9 123779846 missense probably damaging 1.00
IGL03151:Ccr9 APN 9 123774573 utr 5 prime probably benign
IGL03302:Ccr9 APN 9 123779536 missense probably damaging 1.00
R0310:Ccr9 UTSW 9 123774552 utr 5 prime probably benign
R0421:Ccr9 UTSW 9 123779606 missense probably benign
R2069:Ccr9 UTSW 9 123779364 missense probably benign 0.05
R3980:Ccr9 UTSW 9 123779376 missense probably benign 0.14
R4645:Ccr9 UTSW 9 123779593 missense probably benign 0.00
R4672:Ccr9 UTSW 9 123779687 missense probably damaging 0.96
R4920:Ccr9 UTSW 9 123779439 missense probably damaging 1.00
R5661:Ccr9 UTSW 9 123780099 missense probably benign 0.04
R5964:Ccr9 UTSW 9 123779434 missense probably benign 0.12
R7037:Ccr9 UTSW 9 123779971 missense possibly damaging 0.52
R7500:Ccr9 UTSW 9 123779469 missense probably damaging 1.00
R7620:Ccr9 UTSW 9 123779846 missense probably damaging 1.00
R7670:Ccr9 UTSW 9 123779306 missense probably damaging 0.98
R7762:Ccr9 UTSW 9 123779957 missense probably benign 0.08
X0026:Ccr9 UTSW 9 123779501 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCTCTGCACCCCAGAAATC -3'
(R):5'- CTGGCTAATGCATCCCAGGTTCTTC -3'

Sequencing Primer
(F):5'- AGTCAGCTGTCTTGATCCTG -3'
(R):5'- TGCAATAGTCTGAGTAACCTGG -3'
Posted On2013-04-24