Incidental Mutation 'R1960:Slc25a25'
ID318002
Institutional Source Beutler Lab
Gene Symbol Slc25a25
Ensembl Gene ENSMUSG00000026819
Gene Namesolute carrier family 25 (mitochondrial carrier, phosphate carrier), member 25
Synonyms1110030N17Rik
MMRRC Submission 039974-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1960 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32414487-32451445 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 32420651 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000028160] [ENSMUST00000052119] [ENSMUST00000113307] [ENSMUST00000113308] [ENSMUST00000113310] [ENSMUST00000136361] [ENSMUST00000153886]
Predicted Effect probably null
Transcript: ENSMUST00000028160
SMART Domains Protein: ENSMUSP00000028160
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
EFh 48 76 8.73e0 SMART
EFh 84 112 2.64e-1 SMART
EFh 115 143 1.36e0 SMART
Blast:EFh 151 191 1e-9 BLAST
Pfam:Mito_carr 227 320 1.7e-26 PFAM
Pfam:Mito_carr 321 413 6.4e-26 PFAM
Pfam:Mito_carr 418 512 9.9e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000052119
SMART Domains Protein: ENSMUSP00000060581
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EFh 71 99 4.53e0 SMART
EFh 102 130 1.36e0 SMART
Blast:EFh 138 178 2e-9 BLAST
Pfam:Mito_carr 214 307 1.2e-26 PFAM
Pfam:Mito_carr 308 400 2.5e-27 PFAM
Pfam:Mito_carr 405 500 4.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113307
SMART Domains Protein: ENSMUSP00000108932
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
EFh 51 79 9.51e0 SMART
EFh 82 110 1.36e0 SMART
EFh 118 146 8.82e1 SMART
Pfam:Mito_carr 182 275 1.1e-26 PFAM
Pfam:Mito_carr 276 368 2.2e-27 PFAM
Pfam:Mito_carr 373 468 4.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113308
SMART Domains Protein: ENSMUSP00000108933
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EFh 71 99 4.53e0 SMART
EFh 102 130 1.36e0 SMART
EFh 138 166 8.82e1 SMART
Pfam:Mito_carr 202 295 1.1e-26 PFAM
Pfam:Mito_carr 296 388 2.4e-27 PFAM
Pfam:Mito_carr 393 488 4.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113310
SMART Domains Protein: ENSMUSP00000108936
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
EFh 48 76 8.73e0 SMART
EFh 84 112 2.64e-1 SMART
EFh 115 143 1.36e0 SMART
EFh 151 179 8.82e1 SMART
Pfam:Mito_carr 215 308 1.2e-26 PFAM
Pfam:Mito_carr 309 401 2.5e-27 PFAM
Pfam:Mito_carr 406 501 4.9e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127961
SMART Domains Protein: ENSMUSP00000121932
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
EFh 36 64 8.99e0 SMART
EFh 67 95 1.36e0 SMART
Blast:EFh 103 143 1e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128611
Predicted Effect probably benign
Transcript: ENSMUST00000136361
SMART Domains Protein: ENSMUSP00000115617
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
EFh 36 64 8.99e0 SMART
EFh 67 95 1.36e0 SMART
EFh 103 131 8.82e1 SMART
Pfam:Mito_carr 167 260 9.3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153782
Predicted Effect probably benign
Transcript: ENSMUST00000153886
SMART Domains Protein: ENSMUSP00000141486
Gene: ENSMUSG00000026819

DomainStartEndE-ValueType
SCOP:d1exra_ 1 38 1e-4 SMART
Blast:EFh 15 43 2e-13 BLAST
Pfam:Mito_carr 79 112 1.1e-7 PFAM
Meta Mutation Damage Score 0.6284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of calcium-binding mitochondrial carriers, with a characteristic mitochondrial carrier domain at the C-terminus. These proteins are found in the inner membranes of mitochondria, and function as transport proteins. They shuttle metabolites, nucleotides and cofactors through the mitochondrial membrane and thereby connect and/or regulate cytoplasm and matrix functions. This protein may function as an ATP-Mg/Pi carrier that mediates the transport of Mg-ATP in exchange for phosphate, and likely responsible for the net uptake or efflux of adenine nucleotides into or from the mitochondria. Alternatively spliced transcript variants encoding different isoforms with a common C-terminus but variable N-termini have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced physical endurance and metabolic efficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik C T 3: 145,938,221 P55S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arid1a A T 4: 133,753,090 H174Q possibly damaging Het
Btbd2 A G 10: 80,644,705 I358T probably benign Het
Camkk2 G A 5: 122,737,512 R492* probably null Het
Capn3 T C 2: 120,463,940 V23A probably benign Het
Carm1 T G 9: 21,580,310 V225G probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc60 C A 5: 116,146,184 M298I probably benign Het
Celsr3 C T 9: 108,845,817 P2801L probably benign Het
Clec4n T A 6: 123,230,546 V23E probably damaging Het
Cmtr2 T G 8: 110,221,750 L231V probably damaging Het
Csrnp3 T G 2: 66,023,019 V585G probably null Het
Ctnnd2 T C 15: 30,647,111 S318P probably damaging Het
Cubn A T 2: 13,340,017 probably null Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dnajc24 A G 2: 106,001,923 probably benign Het
Dner A T 1: 84,445,456 S475R probably damaging Het
Doxl2 C T 6: 48,975,753 T204I probably damaging Het
Dtnb T C 12: 3,781,190 L630P probably benign Het
Dysf T C 6: 84,073,903 F411L probably benign Het
Fam208a T C 14: 27,438,664 S128P probably damaging Het
Fam208a C T 14: 27,479,789 H1419Y possibly damaging Het
Fbxo18 G A 2: 11,757,528 A566V probably damaging Het
Fbxw19 G T 9: 109,485,936 T186K probably benign Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Grhl2 T A 15: 37,336,314 V54D probably damaging Het
Hmcn1 T C 1: 150,675,991 I2621V probably benign Het
Hmcn1 T A 1: 150,677,376 E2521V possibly damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kifc1 A G 17: 33,884,587 probably null Het
Klk13 T A 7: 43,721,007 N31K possibly damaging Het
Klri1 T A 6: 129,697,384 H221L probably benign Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Med16 T C 10: 79,907,095 H14R possibly damaging Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mrgpra2a T A 7: 47,427,235 I92F probably benign Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Myo5a T A 9: 75,147,857 F441I probably damaging Het
Ndst4 T A 3: 125,438,682 L300* probably null Het
Nlgn2 G T 11: 69,827,310 D356E probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Oas1f G A 5: 120,856,439 C341Y possibly damaging Het
Olfm5 A T 7: 104,160,412 C111S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr523 A T 7: 140,176,683 I188L probably benign Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr821 C T 10: 130,034,318 Q231* probably null Het
Olfr876 A G 9: 37,803,946 I12V probably benign Het
Olfr919 T A 9: 38,698,204 H58L probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pde10a T C 17: 8,942,918 I477T possibly damaging Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb A T 18: 61,065,783 T338S probably benign Het
Pgghg A G 7: 140,943,347 M180V probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rangap1 T C 15: 81,706,503 T463A probably benign Het
Rap1gds1 T C 3: 139,050,556 I13V probably null Het
Rbak A T 5: 143,174,682 Y205* probably null Het
Reg3b A T 6: 78,371,814 K31M probably damaging Het
Rfpl4 A T 7: 5,115,534 Y12* probably null Het
Rnase6 A G 14: 51,130,432 N94D possibly damaging Het
Rtn4 T C 11: 29,736,464 L273P probably damaging Het
Ryr3 A C 2: 112,794,467 F2203V probably damaging Het
Sae1 A T 7: 16,368,565 D161E possibly damaging Het
Sema5a T C 15: 32,562,731 F296S possibly damaging Het
Sh3rf1 C A 8: 61,384,863 P814Q probably damaging Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slco4c1 T A 1: 96,867,929 M135L probably benign Het
Slfn1 A G 11: 83,121,753 I232V possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Srr A G 11: 74,908,716 V311A probably damaging Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Topors T C 4: 40,261,044 R747G unknown Het
Trank1 A T 9: 111,391,628 I2478F probably damaging Het
Trim69 A G 2: 122,167,684 N46D probably benign Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttn T C 2: 76,814,305 K4708R probably damaging Het
Unkl A G 17: 25,209,645 probably benign Het
Uros A T 7: 133,687,006 N257K probably benign Het
Usp25 A G 16: 77,076,371 Y439C probably damaging Het
Vgf A G 5: 137,032,175 probably benign Het
Vmn2r8 A T 5: 108,799,286 D533E probably damaging Het
Vps13a A T 19: 16,725,631 Y653N probably damaging Het
Zfp358 T C 8: 3,495,742 V135A possibly damaging Het
Other mutations in Slc25a25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Slc25a25 APN 2 32419160 missense probably benign 0.04
IGL01431:Slc25a25 APN 2 32419091 missense probably damaging 1.00
IGL02211:Slc25a25 APN 2 32417440 missense probably damaging 1.00
IGL02393:Slc25a25 APN 2 32417843 missense probably benign 0.40
R0385:Slc25a25 UTSW 2 32417822 missense probably damaging 0.99
R1208:Slc25a25 UTSW 2 32417425 missense probably benign 0.11
R1208:Slc25a25 UTSW 2 32417425 missense probably benign 0.11
R1611:Slc25a25 UTSW 2 32420379 missense probably damaging 1.00
R2405:Slc25a25 UTSW 2 32417719 splice site probably null
R3749:Slc25a25 UTSW 2 32420380 missense probably benign 0.21
R4446:Slc25a25 UTSW 2 32430609 missense probably benign 0.00
R4815:Slc25a25 UTSW 2 32420410 missense probably damaging 1.00
R5245:Slc25a25 UTSW 2 32421328 nonsense probably null
R6884:Slc25a25 UTSW 2 32420662 missense probably benign 0.34
R7144:Slc25a25 UTSW 2 32419166 missense probably damaging 1.00
R7210:Slc25a25 UTSW 2 32420396 missense possibly damaging 0.89
R7255:Slc25a25 UTSW 2 32421372 missense possibly damaging 0.60
X0021:Slc25a25 UTSW 2 32421514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACTTAGATGGGATGGAGGC -3'
(R):5'- AACAGTTTGTACCTGGCTGG -3'

Sequencing Primer
(F):5'- CAGGTGCCATAGCCACC -3'
(R):5'- TGTACCTGGCTGGCCTGAAAG -3'
Posted On2015-05-19