Mutagenetix > Incidental Mutation

Incidental Mutation 'R1960:Ryr3'

318007

Institutional Source

Beutler Lab

Gene Symbol

Ryr3

Ensembl Gene

ENSMUSG00000057378

Gene Name

ryanodine receptor 3

Synonyms

calcium release channel isoform 3

MMRRC Submission

039974-MU

Accession Numbers

Genbank: NM_177652.2

Essential gene?

Possibly non essential (E-score: 0.360) question?

Stock #

R1960 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

112631355-113217096 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 112794467 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 2203 (F2203V)

Ref Sequence

ENSEMBL: ENSMUSP00000147196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080673] [ENSMUST00000091818] [ENSMUST00000134358] [ENSMUST00000208151] [ENSMUST00000208290]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000080673
AA Change: F2203V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000079503
Gene: ENSMUSG00000057378
AA Change: F2203V

Domain	Start	End	E-Value	Type
low complexity region	90	99	N/A	INTRINSIC
MIR	100	155	3.27e-4	SMART
MIR	162	207	7.52e-4	SMART
MIR	215	269	8.06e-4	SMART
MIR	275	368	8.4e-25	SMART
Pfam:RYDR_ITPR	438	642	1.1e-71	PFAM
SPRY	657	795	1.16e-24	SMART
Pfam:RyR	848	942	1.5e-34	PFAM
Pfam:RyR	962	1056	1.2e-32	PFAM
SPRY	1084	1207	7.99e-37	SMART
SPRY	1325	1465	6.25e-30	SMART
low complexity region	1757	1772	N/A	INTRINSIC
low complexity region	1773	1788	N/A	INTRINSIC
low complexity region	1932	1957	N/A	INTRINSIC
Pfam:RYDR_ITPR	2018	2228	1.8e-59	PFAM
Pfam:RyR	2595	2689	1.2e-36	PFAM
Pfam:RyR	2713	2801	2.1e-31	PFAM
low complexity region	2877	2887	N/A	INTRINSIC
low complexity region	3169	3184	N/A	INTRINSIC
low complexity region	3327	3338	N/A	INTRINSIC
PDB:2BCX\|B	3462	3491	9e-12	PDB
low complexity region	3532	3540	N/A	INTRINSIC
coiled coil region	3585	3614	N/A	INTRINSIC
Pfam:RIH_assoc	3715	3848	4.9e-40	PFAM
low complexity region	3855	3875	N/A	INTRINSIC
SCOP:d1sra__	3893	3989	1e-10	SMART
low complexity region	4096	4134	N/A	INTRINSIC
transmembrane domain	4178	4200	N/A	INTRINSIC
Pfam:RR_TM4-6	4227	4497	4.7e-96	PFAM
Pfam:Ion_trans	4599	4762	2e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000091818
AA Change: F2223V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089426
Gene: ENSMUSG00000057378
AA Change: F2223V

Domain	Start	End	E-Value	Type
low complexity region	110	119	N/A	INTRINSIC
MIR	120	175	3.27e-4	SMART
MIR	182	227	7.52e-4	SMART
MIR	235	289	8.06e-4	SMART
MIR	295	388	8.4e-25	SMART
Pfam:RYDR_ITPR	460	655	1.2e-64	PFAM
SPRY	677	815	1.16e-24	SMART
Pfam:RyR	869	959	3.3e-38	PFAM
Pfam:RyR	983	1073	2.5e-32	PFAM
SPRY	1104	1227	7.99e-37	SMART
SPRY	1345	1485	6.25e-30	SMART
low complexity region	1777	1792	N/A	INTRINSIC
low complexity region	1793	1808	N/A	INTRINSIC
low complexity region	1952	1977	N/A	INTRINSIC
Pfam:RYDR_ITPR	2040	2248	5.8e-67	PFAM
Pfam:RyR	2616	2706	6.3e-33	PFAM
Pfam:RyR	2734	2818	6.6e-26	PFAM
low complexity region	2897	2907	N/A	INTRINSIC
low complexity region	3189	3204	N/A	INTRINSIC
PDB:2BCX\|B	3487	3516	1e-11	PDB
low complexity region	3557	3565	N/A	INTRINSIC
coiled coil region	3610	3639	N/A	INTRINSIC
Pfam:RIH_assoc	3744	3862	3.5e-34	PFAM
low complexity region	3880	3900	N/A	INTRINSIC
SCOP:d1sra__	3918	4014	1e-10	SMART
low complexity region	4121	4159	N/A	INTRINSIC
transmembrane domain	4203	4225	N/A	INTRINSIC
Pfam:RR_TM4-6	4252	4522	1.1e-98	PFAM
Pfam:Ion_trans	4625	4799	6.2e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000134358
AA Change: F2203V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208151
AA Change: F2203V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000208290
AA Change: F2203V

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Meta Mutation Damage Score

0.6797

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

100% (95/95)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ryanodine receptor, which functions to release calcium from intracellular storage for use in many cellular processes. For example, the encoded protein is involved in skeletal muscle contraction by releasing calcium from the sarcoplasmic reticulum followed by depolarization of T-tubules. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired muscle contraction at an early age, changes in hippocampal synaptic plasticity, increased locomotor activity with a tendency to circle, and impaired relearning of a spatial task. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted, knock-out(5) Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410004B18Rik	C	T	3: 145,938,221	P55S	probably damaging	Het
Adgre4	T	C	17: 55,791,497	S136P	probably benign	Het
Als2cr12	A	T	1: 58,659,278	V327D	possibly damaging	Het
Arap1	C	A	7: 101,373,015	A8E	probably damaging	Het
Arid1a	A	T	4: 133,753,090	H174Q	possibly damaging	Het
Btbd2	A	G	10: 80,644,705	I358T	probably benign	Het
Camkk2	G	A	5: 122,737,512	R492*	probably null	Het
Capn3	T	C	2: 120,463,940	V23A	probably benign	Het
Carm1	T	G	9: 21,580,310	V225G	probably benign	Het
Ccdc113	T	A	8: 95,540,831	N141K	probably benign	Het
Ccdc60	C	A	5: 116,146,184	M298I	probably benign	Het
Celsr3	C	T	9: 108,845,817	P2801L	probably benign	Het
Clec4n	T	A	6: 123,230,546	V23E	probably damaging	Het
Cmtr2	T	G	8: 110,221,750	L231V	probably damaging	Het
Csrnp3	T	G	2: 66,023,019	V585G	probably null	Het
Ctnnd2	T	C	15: 30,647,111	S318P	probably damaging	Het
Cubn	A	T	2: 13,340,017		probably null	Het
Dgkd	C	A	1: 87,929,827	P754T	possibly damaging	Het
Dnah7a	A	G	1: 53,684,983	S108P	probably benign	Het
Dnajc24	A	G	2: 106,001,923		probably benign	Het
Dner	A	T	1: 84,445,456	S475R	probably damaging	Het
Doxl2	C	T	6: 48,975,753	T204I	probably damaging	Het
Dtnb	T	C	12: 3,781,190	L630P	probably benign	Het
Dysf	T	C	6: 84,073,903	F411L	probably benign	Het
Fam208a	T	C	14: 27,438,664	S128P	probably damaging	Het
Fam208a	C	T	14: 27,479,789	H1419Y	possibly damaging	Het
Fbxo18	G	A	2: 11,757,528	A566V	probably damaging	Het
Fbxw19	G	T	9: 109,485,936	T186K	probably benign	Het
Gm4825	A	G	15: 85,511,044		noncoding transcript	Het
Grhl2	T	A	15: 37,336,314	V54D	probably damaging	Het
Hmcn1	T	C	1: 150,675,991	I2621V	probably benign	Het
Hmcn1	T	A	1: 150,677,376	E2521V	possibly damaging	Het
Kcng1	A	G	2: 168,262,984	V314A	probably benign	Het
Kif13a	G	A	13: 46,864,838		probably benign	Het
Kif21a	G	A	15: 90,970,848	A703V	probably damaging	Het
Kifc1	A	G	17: 33,884,587		probably null	Het
Klk13	T	A	7: 43,721,007	N31K	possibly damaging	Het
Klri1	T	A	6: 129,697,384	H221L	probably benign	Het
Ltbp4	G	A	7: 27,329,018	P273L	unknown	Het
Med16	T	C	10: 79,907,095	H14R	possibly damaging	Het
Mpeg1	G	A	19: 12,462,911	V578M	probably damaging	Het
Mrgpra2a	T	A	7: 47,427,235	I92F	probably benign	Het
Muc5b	T	C	7: 141,862,637	C3107R	possibly damaging	Het
Myo5a	T	A	9: 75,147,857	F441I	probably damaging	Het
Ndst4	T	A	3: 125,438,682	L300*	probably null	Het
Nlgn2	G	T	11: 69,827,310	D356E	probably damaging	Het
Nlrp2	T	C	7: 5,327,738	E553G	probably damaging	Het
Oas1f	G	A	5: 120,856,439	C341Y	possibly damaging	Het
Olfm5	A	T	7: 104,160,412	C111S	possibly damaging	Het
Olfr1176	T	C	2: 88,340,201	L212P	probably damaging	Het
Olfr523	A	T	7: 140,176,683	I188L	probably benign	Het
Olfr697	T	C	7: 106,741,394	E180G	probably damaging	Het
Olfr821	C	T	10: 130,034,318	Q231*	probably null	Het
Olfr876	A	G	9: 37,803,946	I12V	probably benign	Het
Olfr919	T	A	9: 38,698,204	H58L	probably benign	Het
Oplah	G	A	15: 76,297,464	T1119I	probably damaging	Het
Pde10a	T	C	17: 8,942,918	I477T	possibly damaging	Het
Pde4b	A	G	4: 102,597,460	E108G	probably damaging	Het
Pdgfrb	A	T	18: 61,065,783	T338S	probably benign	Het
Pgghg	A	G	7: 140,943,347	M180V	probably benign	Het
Phactr4	G	A	4: 132,377,248	T256I	probably benign	Het
Pot1b	A	T	17: 55,662,531	Y546N	probably damaging	Het
Rangap1	T	C	15: 81,706,503	T463A	probably benign	Het
Rap1gds1	T	C	3: 139,050,556	I13V	probably null	Het
Rbak	A	T	5: 143,174,682	Y205*	probably null	Het
Reg3b	A	T	6: 78,371,814	K31M	probably damaging	Het
Rfpl4	A	T	7: 5,115,534	Y12*	probably null	Het
Rnase6	A	G	14: 51,130,432	N94D	possibly damaging	Het
Rtn4	T	C	11: 29,736,464	L273P	probably damaging	Het
Sae1	A	T	7: 16,368,565	D161E	possibly damaging	Het
Sema5a	T	C	15: 32,562,731	F296S	possibly damaging	Het
Sh3rf1	C	A	8: 61,384,863	P814Q	probably damaging	Het
Slc22a29	C	A	19: 8,169,193	R415M	probably benign	Het
Slc25a25	C	T	2: 32,420,651		probably null	Het
Slco4c1	T	A	1: 96,867,929	M135L	probably benign	Het
Slfn1	A	G	11: 83,121,753	I232V	possibly damaging	Het
Slitrk1	T	A	14: 108,912,190	N363I	probably damaging	Het
Srr	A	G	11: 74,908,716	V311A	probably damaging	Het
Tenm1	T	C	X: 42,827,201	D402G	probably benign	Het
Topors	T	C	4: 40,261,044	R747G	unknown	Het
Trank1	A	T	9: 111,391,628	I2478F	probably damaging	Het
Trim69	A	G	2: 122,167,684	N46D	probably benign	Het
Trpm1	T	A	7: 64,230,230	L661Q	probably damaging	Het
Ttbk1	A	C	17: 46,480,224	F45V	probably damaging	Het
Ttn	T	C	2: 76,814,305	K4708R	probably damaging	Het
Unkl	A	G	17: 25,209,645		probably benign	Het
Uros	A	T	7: 133,687,006	N257K	probably benign	Het
Usp25	A	G	16: 77,076,371	Y439C	probably damaging	Het
Vgf	A	G	5: 137,032,175		probably benign	Het
Vmn2r8	A	T	5: 108,799,286	D533E	probably damaging	Het
Vps13a	A	T	19: 16,725,631	Y653N	probably damaging	Het
Zfp358	T	C	8: 3,495,742	V135A	possibly damaging	Het

Other mutations in Ryr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Ryr3	APN	2	112660149	missense	probably damaging	0.98
IGL00531:Ryr3	APN	2	112663012	splice site	probably benign
IGL00785:Ryr3	APN	2	112836103	missense	possibly damaging	0.95
IGL00901:Ryr3	APN	2	112886589	missense	probably damaging	1.00
IGL00910:Ryr3	APN	2	112728934	splice site	probably benign
IGL00970:Ryr3	APN	2	112764676	missense	probably damaging	1.00
IGL01083:Ryr3	APN	2	112751846	splice site	probably benign
IGL01105:Ryr3	APN	2	112751805	missense	probably damaging	1.00
IGL01287:Ryr3	APN	2	112709073	missense	probably damaging	1.00
IGL01343:Ryr3	APN	2	112660054	missense	probably damaging	1.00
IGL01472:Ryr3	APN	2	112672248	missense	probably benign	0.20
IGL01552:Ryr3	APN	2	112825883	missense	possibly damaging	0.53
IGL01594:Ryr3	APN	2	112772728	missense	probably damaging	1.00
IGL01723:Ryr3	APN	2	112650111	critical splice donor site	probably null
IGL01837:Ryr3	APN	2	112801320	missense	probably damaging	1.00
IGL01868:Ryr3	APN	2	112803158	splice site	probably benign
IGL01907:Ryr3	APN	2	112869001	splice site	probably benign
IGL02005:Ryr3	APN	2	112663263	splice site	probably benign
IGL02014:Ryr3	APN	2	112946915	missense	possibly damaging	0.86
IGL02109:Ryr3	APN	2	112949157	missense	probably benign
IGL02178:Ryr3	APN	2	112825799	missense	probably benign	0.17
IGL02185:Ryr3	APN	2	112967203	missense	probably damaging	0.99
IGL02189:Ryr3	APN	2	112754838	splice site	probably benign
IGL02200:Ryr3	APN	2	112849510	missense	probably damaging	0.98
IGL02302:Ryr3	APN	2	112964356	missense	probably damaging	1.00
IGL02305:Ryr3	APN	2	112645277	missense	probably damaging	0.96
IGL02306:Ryr3	APN	2	112834114	missense	probably damaging	0.98
IGL02306:Ryr3	APN	2	112847399	critical splice donor site	probably null
IGL02340:Ryr3	APN	2	112947004	splice site	probably benign
IGL02398:Ryr3	APN	2	112847422	missense	probably benign	0.05
IGL02407:Ryr3	APN	2	112754958	missense	probably damaging	1.00
IGL02426:Ryr3	APN	2	112900905	missense	possibly damaging	0.59
IGL02452:Ryr3	APN	2	112833990	missense	probably damaging	1.00
IGL02453:Ryr3	APN	2	112681728	splice site	probably benign
IGL02585:Ryr3	APN	2	112712303	missense	probably damaging	1.00
IGL02724:Ryr3	APN	2	112902576	critical splice donor site	probably null
IGL02817:Ryr3	APN	2	112844623	critical splice donor site	probably null
IGL02861:Ryr3	APN	2	112652841	missense	possibly damaging	0.89
IGL03038:Ryr3	APN	2	112668120	missense	possibly damaging	0.83
IGL03059:Ryr3	APN	2	112800047	missense	probably damaging	1.00
IGL03136:Ryr3	APN	2	112675974	splice site	probably benign
IGL03137:Ryr3	APN	2	112910397	missense	probably benign
IGL03166:Ryr3	APN	2	112641112	nonsense	probably null
IGL03177:Ryr3	APN	2	113028671	missense	probably benign	0.39
IGL03205:Ryr3	APN	2	112632142	missense	probably damaging	1.00
IGL03224:Ryr3	APN	2	112954336	nonsense	probably null
IGL03249:Ryr3	APN	2	112640656	missense	probably benign	0.32
IGL03370:Ryr3	APN	2	112756599	missense	possibly damaging	0.69
intruder	UTSW	2	112672246	nonsense	probably null
usurper	UTSW	2	112800022	missense	probably damaging	1.00
ANU74:Ryr3	UTSW	2	112831230	critical splice acceptor site	probably null
BB006:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
BB016:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
F5426:Ryr3	UTSW	2	112766338	splice site	probably benign
PIT4494001:Ryr3	UTSW	2	112841876	missense	probably damaging	0.99
R0022:Ryr3	UTSW	2	112640666	missense	probably damaging	1.00
R0022:Ryr3	UTSW	2	112640666	missense	probably damaging	1.00
R0051:Ryr3	UTSW	2	112869075	missense	probably damaging	1.00
R0051:Ryr3	UTSW	2	112869075	missense	probably damaging	1.00
R0085:Ryr3	UTSW	2	112859763	missense	probably damaging	1.00
R0097:Ryr3	UTSW	2	112800055	missense	probably damaging	1.00
R0097:Ryr3	UTSW	2	112800055	missense	probably damaging	1.00
R0098:Ryr3	UTSW	2	112901031	missense	probably damaging	1.00
R0098:Ryr3	UTSW	2	112901031	missense	probably damaging	1.00
R0116:Ryr3	UTSW	2	112803165	missense	probably damaging	0.99
R0281:Ryr3	UTSW	2	112686810	missense	probably damaging	1.00
R0302:Ryr3	UTSW	2	112647123	splice site	probably benign
R0306:Ryr3	UTSW	2	112775655	critical splice donor site	probably null
R0445:Ryr3	UTSW	2	112866054	missense	probably benign	0.16
R0463:Ryr3	UTSW	2	112661701	missense	probably damaging	1.00
R0592:Ryr3	UTSW	2	112678481	missense	probably damaging	1.00
R0622:Ryr3	UTSW	2	112662555	missense	probably damaging	1.00
R0656:Ryr3	UTSW	2	112648306	splice site	probably benign
R0735:Ryr3	UTSW	2	112732982	missense	probably benign	0.11
R0783:Ryr3	UTSW	2	112756327	splice site	probably benign
R0789:Ryr3	UTSW	2	112780973	splice site	probably null
R0835:Ryr3	UTSW	2	112650138	missense	probably benign	0.16
R0879:Ryr3	UTSW	2	113030243	missense	probably benign	0.02
R0924:Ryr3	UTSW	2	112841833	missense	probably damaging	1.00
R0930:Ryr3	UTSW	2	112841833	missense	probably damaging	1.00
R0931:Ryr3	UTSW	2	112653702	missense	probably damaging	1.00
R1037:Ryr3	UTSW	2	112869108	missense	probably benign	0.42
R1169:Ryr3	UTSW	2	112733014	missense	probably benign	0.01
R1170:Ryr3	UTSW	2	112946987	missense	probably damaging	1.00
R1178:Ryr3	UTSW	2	112964380	missense	probably benign	0.00
R1187:Ryr3	UTSW	2	112958176	missense	probably damaging	1.00
R1289:Ryr3	UTSW	2	112645285	missense	probably damaging	1.00
R1337:Ryr3	UTSW	2	112779963	missense	possibly damaging	0.46
R1342:Ryr3	UTSW	2	112750803	missense	probably damaging	1.00
R1349:Ryr3	UTSW	2	112834201	missense	probably damaging	1.00
R1372:Ryr3	UTSW	2	112834201	missense	probably damaging	1.00
R1434:Ryr3	UTSW	2	112645259	missense	probably damaging	1.00
R1438:Ryr3	UTSW	2	112757701	missense	probably benign	0.18
R1467:Ryr3	UTSW	2	112753002	splice site	probably benign
R1470:Ryr3	UTSW	2	112653007	missense	probably benign
R1470:Ryr3	UTSW	2	112653007	missense	probably benign
R1474:Ryr3	UTSW	2	112909962	missense	probably damaging	1.00
R1481:Ryr3	UTSW	2	112636522	splice site	probably benign
R1513:Ryr3	UTSW	2	112709197	nonsense	probably null
R1524:Ryr3	UTSW	2	112869082	missense	probably damaging	0.98
R1525:Ryr3	UTSW	2	112678090	missense	probably damaging	1.00
R1526:Ryr3	UTSW	2	112661657	missense	probably damaging	1.00
R1611:Ryr3	UTSW	2	112653505	missense	possibly damaging	0.72
R1640:Ryr3	UTSW	2	112900833	missense	probably damaging	1.00
R1662:Ryr3	UTSW	2	112709273	missense	probably damaging	0.99
R1764:Ryr3	UTSW	2	112860460	missense	probably damaging	1.00
R1769:Ryr3	UTSW	2	112751768	critical splice donor site	probably null
R1776:Ryr3	UTSW	2	112957253	missense	probably damaging	0.99
R1780:Ryr3	UTSW	2	112867292	missense	probably damaging	0.98
R1840:Ryr3	UTSW	2	112750820	missense	probably damaging	1.00
R1864:Ryr3	UTSW	2	112730328	missense	possibly damaging	0.65
R1872:Ryr3	UTSW	2	112709137	missense	possibly damaging	0.94
R1994:Ryr3	UTSW	2	112654492	missense	probably null	0.93
R2018:Ryr3	UTSW	2	112781065	missense	probably benign	0.24
R2019:Ryr3	UTSW	2	112781065	missense	probably benign	0.24
R2029:Ryr3	UTSW	2	112647016	missense	possibly damaging	0.82
R2051:Ryr3	UTSW	2	112756641	missense	probably damaging	1.00
R2060:Ryr3	UTSW	2	112954364	missense	possibly damaging	0.92
R2061:Ryr3	UTSW	2	112663004	missense	possibly damaging	0.83
R2067:Ryr3	UTSW	2	112946957	missense	probably damaging	1.00
R2106:Ryr3	UTSW	2	112638129	missense	probably damaging	1.00
R2129:Ryr3	UTSW	2	112678370	splice site	probably benign
R2140:Ryr3	UTSW	2	112875148	missense	probably benign	0.01
R2176:Ryr3	UTSW	2	112666335	missense	possibly damaging	0.48
R2241:Ryr3	UTSW	2	112801392	missense	probably damaging	1.00
R2261:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R2262:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R2276:Ryr3	UTSW	2	112649319	missense	possibly damaging	0.79
R2279:Ryr3	UTSW	2	112649319	missense	possibly damaging	0.79
R2403:Ryr3	UTSW	2	112686628	missense	probably damaging	1.00
R2510:Ryr3	UTSW	2	112675904	missense	probably benign	0.18
R2568:Ryr3	UTSW	2	112675874	missense	probably damaging	1.00
R3013:Ryr3	UTSW	2	112640281	missense	probably damaging	1.00
R3431:Ryr3	UTSW	2	112656531	missense	probably damaging	1.00
R3552:Ryr3	UTSW	2	112751787	missense	probably damaging	1.00
R3761:Ryr3	UTSW	2	112754913	missense	probably benign
R3909:Ryr3	UTSW	2	112636608	missense	probably damaging	1.00
R3923:Ryr3	UTSW	2	112841873	missense	possibly damaging	0.92
R3924:Ryr3	UTSW	2	113028703	splice site	probably benign
R3927:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3947:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3949:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R3976:Ryr3	UTSW	2	112675837	missense	possibly damaging	0.49
R4004:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4022:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4084:Ryr3	UTSW	2	112900908	missense	probably damaging	0.99
R4106:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4108:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4109:Ryr3	UTSW	2	112675873	missense	probably damaging	0.99
R4131:Ryr3	UTSW	2	112926983	splice site	probably null
R4156:Ryr3	UTSW	2	112653675	missense	probably damaging	1.00
R4172:Ryr3	UTSW	2	112794470	missense	probably damaging	1.00
R4234:Ryr3	UTSW	2	112910407	missense	probably damaging	1.00
R4399:Ryr3	UTSW	2	112946844	missense	probably benign	0.01
R4409:Ryr3	UTSW	2	112730308	missense	probably damaging	1.00
R4418:Ryr3	UTSW	2	112831224	missense	probably damaging	1.00
R4466:Ryr3	UTSW	2	112653102	missense	possibly damaging	0.92
R4525:Ryr3	UTSW	2	112653621	missense	probably damaging	0.98
R4573:Ryr3	UTSW	2	112755174	splice site	probably null
R4589:Ryr3	UTSW	2	112875133	missense	probably damaging	1.00
R4653:Ryr3	UTSW	2	112652763	missense	probably damaging	1.00
R4664:Ryr3	UTSW	2	112996555	intron	probably benign
R4710:Ryr3	UTSW	2	112766301	missense	probably damaging	1.00
R4734:Ryr3	UTSW	2	112910502	missense	probably damaging	0.99
R4741:Ryr3	UTSW	2	112803268	missense	probably damaging	0.99
R4748:Ryr3	UTSW	2	112964405	missense	possibly damaging	0.95
R4749:Ryr3	UTSW	2	112964405	missense	possibly damaging	0.95
R4754:Ryr3	UTSW	2	112757639	missense	possibly damaging	0.94
R4764:Ryr3	UTSW	2	112733031	critical splice acceptor site	probably null
R4812:Ryr3	UTSW	2	112912236	missense	probably damaging	1.00
R4822:Ryr3	UTSW	2	112652745	missense	probably damaging	1.00
R4841:Ryr3	UTSW	2	112648373	missense	probably damaging	1.00
R4849:Ryr3	UTSW	2	112908462	missense	probably damaging	1.00
R4917:Ryr3	UTSW	2	112831185	missense	probably damaging	1.00
R4942:Ryr3	UTSW	2	112836257	missense	probably damaging	0.99
R4990:Ryr3	UTSW	2	112635777	missense	probably damaging	1.00
R4990:Ryr3	UTSW	2	112909973	missense	probably damaging	1.00
R5049:Ryr3	UTSW	2	112640171	missense	probably damaging	1.00
R5055:Ryr3	UTSW	2	112831159	missense	probably benign	0.00
R5112:Ryr3	UTSW	2	112902665	missense	probably damaging	1.00
R5160:Ryr3	UTSW	2	112646927	missense	probably damaging	1.00
R5169:Ryr3	UTSW	2	112670660	missense	possibly damaging	0.63
R5176:Ryr3	UTSW	2	112757667	missense	possibly damaging	0.95
R5182:Ryr3	UTSW	2	112755150	missense	probably damaging	1.00
R5206:Ryr3	UTSW	2	112844711	missense	probably damaging	1.00
R5263:Ryr3	UTSW	2	112718002	missense	possibly damaging	0.65
R5272:Ryr3	UTSW	2	112653213	missense	probably damaging	1.00
R5332:Ryr3	UTSW	2	112902693	missense	probably damaging	1.00
R5340:Ryr3	UTSW	2	112834125	missense	probably damaging	0.99
R5359:Ryr3	UTSW	2	112775841	splice site	probably null
R5434:Ryr3	UTSW	2	112794469	missense	probably damaging	1.00
R5454:Ryr3	UTSW	2	112730302	splice site	probably null
R5501:Ryr3	UTSW	2	112662504	missense	possibly damaging	0.80
R5560:Ryr3	UTSW	2	112754877	missense	probably damaging	1.00
R5580:Ryr3	UTSW	2	112841948	missense	probably damaging	1.00
R5621:Ryr3	UTSW	2	112900984	nonsense	probably null
R5731:Ryr3	UTSW	2	112641572	missense	probably damaging	1.00
R5757:Ryr3	UTSW	2	112841975	missense	probably damaging	1.00
R5758:Ryr3	UTSW	2	112841975	missense	probably damaging	1.00
R5768:Ryr3	UTSW	2	112753097	missense	probably benign	0.05
R5783:Ryr3	UTSW	2	112652998	missense	probably benign	0.06
R5799:Ryr3	UTSW	2	112686580	missense	probably damaging	1.00
R5829:Ryr3	UTSW	2	112859731	missense	probably damaging	1.00
R5883:Ryr3	UTSW	2	113030292	intron	probably benign
R5911:Ryr3	UTSW	2	112908487	missense	probably damaging	1.00
R5968:Ryr3	UTSW	2	112647049	missense	probably benign	0.22
R5972:Ryr3	UTSW	2	112834064	missense	probably damaging	0.99
R5978:Ryr3	UTSW	2	112672269	missense	probably benign	0.00
R6084:Ryr3	UTSW	2	112908493	missense	probably damaging	1.00
R6117:Ryr3	UTSW	2	112635396	missense	probably damaging	1.00
R6126:Ryr3	UTSW	2	112757670	missense	probably damaging	1.00
R6128:Ryr3	UTSW	2	112954294	critical splice donor site	probably null
R6157:Ryr3	UTSW	2	112841899	missense	probably damaging	0.98
R6258:Ryr3	UTSW	2	112660104	missense	probably damaging	1.00
R6260:Ryr3	UTSW	2	112660104	missense	probably damaging	1.00
R6373:Ryr3	UTSW	2	112656544	missense	probably damaging	1.00
R6377:Ryr3	UTSW	2	112632185	missense	probably damaging	1.00
R6443:Ryr3	UTSW	2	112675933	missense	possibly damaging	0.88
R6478:Ryr3	UTSW	2	112660068	missense	probably damaging	1.00
R6512:Ryr3	UTSW	2	112867378	missense	possibly damaging	0.83
R6684:Ryr3	UTSW	2	112753088	missense	probably damaging	1.00
R6753:Ryr3	UTSW	2	112652610	missense	probably damaging	0.99
R6812:Ryr3	UTSW	2	112946906	missense	probably damaging	1.00
R6910:Ryr3	UTSW	2	112958175	missense	probably damaging	1.00
R6930:Ryr3	UTSW	2	112860354	missense	probably damaging	1.00
R6946:Ryr3	UTSW	2	112831200	missense	probably damaging	1.00
R6950:Ryr3	UTSW	2	112686825	missense	possibly damaging	0.78
R6973:Ryr3	UTSW	2	112766311	missense	probably damaging	0.99
R6984:Ryr3	UTSW	2	112875091	missense	probably damaging	1.00
R7020:Ryr3	UTSW	2	112753078	missense	probably benign	0.00
R7037:Ryr3	UTSW	2	112949130	nonsense	probably null
R7166:Ryr3	UTSW	2	112875028	missense	probably damaging	1.00
R7172:Ryr3	UTSW	2	112661657	missense	probably damaging	1.00
R7177:Ryr3	UTSW	2	112900843	missense	probably damaging	1.00
R7188:Ryr3	UTSW	2	113028644	missense	probably damaging	1.00
R7202:Ryr3	UTSW	2	112766319	missense	probably damaging	1.00
R7228:Ryr3	UTSW	2	112861852	missense	probably damaging	1.00
R7256:Ryr3	UTSW	2	112672246	nonsense	probably null
R7293:Ryr3	UTSW	2	112902603	missense	probably benign	0.13
R7331:Ryr3	UTSW	2	112763665	missense	possibly damaging	0.80
R7380:Ryr3	UTSW	2	112640157	missense	probably damaging	1.00
R7391:Ryr3	UTSW	2	112780977	critical splice donor site	probably null
R7455:Ryr3	UTSW	2	112728866	missense	probably damaging	0.99
R7466:Ryr3	UTSW	2	112926957	missense	probably benign	0.40
R7481:Ryr3	UTSW	2	112678093	missense	probably benign	0.16
R7481:Ryr3	UTSW	2	112678094	missense	possibly damaging	0.95
R7497:Ryr3	UTSW	2	112730473	missense	probably benign	0.06
R7502:Ryr3	UTSW	2	112712361	missense	probably benign	0.00
R7505:Ryr3	UTSW	2	112712429	missense	probably damaging	0.99
R7581:Ryr3	UTSW	2	112753027	missense	probably damaging	0.99
R7606:Ryr3	UTSW	2	112645245	nonsense	probably null
R7677:Ryr3	UTSW	2	112833900	missense	probably benign
R7703:Ryr3	UTSW	2	112859765	missense	probably damaging	1.00
R7713:Ryr3	UTSW	2	112635346	missense	probably benign	0.12
R7784:Ryr3	UTSW	2	112775695	missense	probably damaging	1.00
R7831:Ryr3	UTSW	2	112926838	missense	possibly damaging	0.92
R7851:Ryr3	UTSW	2	112678517	missense	probably benign	0.05
R7873:Ryr3	UTSW	2	112730428	missense	probably benign	0.28
R7890:Ryr3	UTSW	2	112926912	missense	probably damaging	1.00
R7899:Ryr3	UTSW	2	112646950	missense	possibly damaging	0.86
R7904:Ryr3	UTSW	2	112781024	missense	probably damaging	1.00
R7929:Ryr3	UTSW	2	112834188	missense	probably benign	0.00
R7982:Ryr3	UTSW	2	112669249	small deletion	probably benign
R8018:Ryr3	UTSW	2	112678432	missense	probably damaging	1.00
R8043:Ryr3	UTSW	2	112775664	missense	probably damaging	1.00
R8043:Ryr3	UTSW	2	112875077	missense	probably damaging	1.00
R8095:Ryr3	UTSW	2	112668043	critical splice donor site	probably null
R8097:Ryr3	UTSW	2	112670270	splice site	probably null
R8181:Ryr3	UTSW	2	112778243	missense	probably damaging	0.98
R8276:Ryr3	UTSW	2	112640617	missense	probably damaging	1.00
R8329:Ryr3	UTSW	2	112662510	missense	possibly damaging	0.94
R8345:Ryr3	UTSW	2	112652925	missense	probably benign	0.01
R8361:Ryr3	UTSW	2	112653130	missense	probably damaging	0.98
R8421:Ryr3	UTSW	2	112996584	missense	probably benign	0.00
R8424:Ryr3	UTSW	2	112841894	missense	possibly damaging	0.91
R8471:Ryr3	UTSW	2	112653780	missense	probably damaging	1.00
R8505:Ryr3	UTSW	2	112675870	missense	probably damaging	0.98
R8535:Ryr3	UTSW	2	112949088	critical splice donor site	probably null
R8540:Ryr3	UTSW	2	112800022	missense	probably damaging	1.00
R8722:Ryr3	UTSW	2	112772771	missense	probably benign	0.12
R8818:Ryr3	UTSW	2	112831096	missense	probably damaging	1.00
R8819:Ryr3	UTSW	2	112635792	missense	probably damaging	1.00
R8819:Ryr3	UTSW	2	112859724	missense	probably benign	0.01
R8820:Ryr3	UTSW	2	112635792	missense	probably damaging	1.00
R8820:Ryr3	UTSW	2	112859724	missense	probably benign	0.01
R8852:Ryr3	UTSW	2	112794499	missense	probably damaging	1.00
R8859:Ryr3	UTSW	2	112653219	missense	probably damaging	0.98
R8896:Ryr3	UTSW	2	112753050	nonsense	probably null
R8916:Ryr3	UTSW	2	112778290	missense	probably damaging	1.00
R8935:Ryr3	UTSW	2	112678057	missense	probably benign	0.33
R8943:Ryr3	UTSW	2	112635324	missense	probably damaging	1.00
R8963:Ryr3	UTSW	2	112836670	critical splice donor site	probably null
R8974:Ryr3	UTSW	2	112912279	missense	possibly damaging	0.74
R9008:Ryr3	UTSW	2	112635403	missense	probably damaging	0.98
R9040:Ryr3	UTSW	2	112954386	missense	probably damaging	1.00
R9041:Ryr3	UTSW	2	112957201	missense	probably damaging	0.97
R9102:Ryr3	UTSW	2	112678561	splice site	probably benign
R9167:Ryr3	UTSW	2	112834053	missense	probably damaging	1.00
R9180:Ryr3	UTSW	2	112661636	missense	probably damaging	0.99
R9219:Ryr3	UTSW	2	112912239	missense	possibly damaging	0.62
R9258:Ryr3	UTSW	2	112653019	missense	probably damaging	0.99
R9300:Ryr3	UTSW	2	112860350	missense	probably benign
R9320:Ryr3	UTSW	2	112779991	missense	probably damaging	1.00
R9325:Ryr3	UTSW	2	112649295	missense	probably damaging	0.96
R9405:Ryr3	UTSW	2	112834267	missense	probably damaging	1.00
R9414:Ryr3	UTSW	2	112670666	missense	possibly damaging	0.81
R9489:Ryr3	UTSW	2	112661621	missense	probably damaging	1.00
R9522:Ryr3	UTSW	2	112730414	missense	probably benign	0.34
R9526:Ryr3	UTSW	2	112833925	missense	probably benign
R9529:Ryr3	UTSW	2	112635315	missense	possibly damaging	0.70
R9605:Ryr3	UTSW	2	112661621	missense	probably damaging	1.00
R9652:Ryr3	UTSW	2	112804702	missense	possibly damaging	0.66
R9660:Ryr3	UTSW	2	112833729	missense	probably benign
R9670:Ryr3	UTSW	2	112730500	missense	probably benign	0.28
R9673:Ryr3	UTSW	2	112656538	missense	possibly damaging	0.93
R9710:Ryr3	UTSW	2	112803189	missense	probably damaging	0.99
R9741:Ryr3	UTSW	2	112646926	missense	probably benign	0.00
R9772:Ryr3	UTSW	2	112826703	missense	probably damaging	0.96
RF010:Ryr3	UTSW	2	112775670	missense	probably damaging	0.97
RF040:Ryr3	UTSW	2	112910524	critical splice acceptor site	probably benign
RF044:Ryr3	UTSW	2	112910524	critical splice acceptor site	probably benign
X0057:Ryr3	UTSW	2	112640159	missense	probably damaging	1.00
X0064:Ryr3	UTSW	2	112912302	missense	probably benign	0.26
Z1088:Ryr3	UTSW	2	112900916	missense	probably damaging	1.00
Z1176:Ryr3	UTSW	2	112675920	missense	probably benign	0.05
Z1176:Ryr3	UTSW	2	112712374	missense	probably damaging	1.00
Z1176:Ryr3	UTSW	2	112728924	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTCTAAGCCCATGTCATGAGC -3'
(R):5'- AGTGTACGCGGACATTGAC -3'

Sequencing Primer
(F):5'- AAGCCCATGTCATGAGCTTCTTG -3'
(R):5'- ACGCGGACATTGACTTTTGTTC -3'

Posted On

2015-05-19