Incidental Mutation 'R1960:Vgf'
ID318024
Institutional Source Beutler Lab
Gene Symbol Vgf
Ensembl Gene ENSMUSG00000037428
Gene NameVGF nerve growth factor inducible
SynonymsLOC381677
MMRRC Submission 039974-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1960 (G1)
Quality Score119
Status Validated
Chromosome5
Chromosomal Location137026392-137033351 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 137032175 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041543] [ENSMUST00000111080] [ENSMUST00000186451] [ENSMUST00000187382] [ENSMUST00000190827]
Predicted Effect unknown
Transcript: ENSMUST00000041543
AA Change: E397G
SMART Domains Protein: ENSMUSP00000048273
Gene: ENSMUSG00000037428
AA Change: E397G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111080
SMART Domains Protein: ENSMUSP00000106709
Gene: ENSMUSG00000004849

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 142 5.6e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154183
Predicted Effect unknown
Transcript: ENSMUST00000186451
AA Change: E397G
SMART Domains Protein: ENSMUSP00000140735
Gene: ENSMUSG00000037428
AA Change: E397G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187382
SMART Domains Protein: ENSMUSP00000140093
Gene: ENSMUSG00000037428

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000190827
AA Change: E397G
SMART Domains Protein: ENSMUSP00000140815
Gene: ENSMUSG00000037428
AA Change: E397G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 110 115 N/A INTRINSIC
low complexity region 147 169 N/A INTRINSIC
low complexity region 179 197 N/A INTRINSIC
low complexity region 218 231 N/A INTRINSIC
coiled coil region 307 412 N/A INTRINSIC
low complexity region 434 450 N/A INTRINSIC
low complexity region 478 488 N/A INTRINSIC
low complexity region 490 504 N/A INTRINSIC
low complexity region 510 518 N/A INTRINSIC
coiled coil region 576 613 N/A INTRINSIC
Meta Mutation Damage Score 0.0686 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in a subpopulation of neuroendocrine cells, and is upregulated by nerve growth factor. The structural organization of this gene is similar to that of the rat gene, and both the translated and the untranslated regions show a high degree of sequence similarity to the rat gene. The encoded secretory protein also shares similarities with the secretogranin/chromogranin family, however, its exact function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are small, lean, hyperactive, hypermetabolic, and infertile. Mutants exhibit markedly reduced leptin levels and altered hypothalamic proopiomelanocortin, neuropeptide Y, and agouti-related peptide expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik C T 3: 145,938,221 P55S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arid1a A T 4: 133,753,090 H174Q possibly damaging Het
Btbd2 A G 10: 80,644,705 I358T probably benign Het
Camkk2 G A 5: 122,737,512 R492* probably null Het
Capn3 T C 2: 120,463,940 V23A probably benign Het
Carm1 T G 9: 21,580,310 V225G probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc60 C A 5: 116,146,184 M298I probably benign Het
Celsr3 C T 9: 108,845,817 P2801L probably benign Het
Clec4n T A 6: 123,230,546 V23E probably damaging Het
Cmtr2 T G 8: 110,221,750 L231V probably damaging Het
Csrnp3 T G 2: 66,023,019 V585G probably null Het
Ctnnd2 T C 15: 30,647,111 S318P probably damaging Het
Cubn A T 2: 13,340,017 probably null Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dnajc24 A G 2: 106,001,923 probably benign Het
Dner A T 1: 84,445,456 S475R probably damaging Het
Doxl2 C T 6: 48,975,753 T204I probably damaging Het
Dtnb T C 12: 3,781,190 L630P probably benign Het
Dysf T C 6: 84,073,903 F411L probably benign Het
Fam208a T C 14: 27,438,664 S128P probably damaging Het
Fam208a C T 14: 27,479,789 H1419Y possibly damaging Het
Fbxo18 G A 2: 11,757,528 A566V probably damaging Het
Fbxw19 G T 9: 109,485,936 T186K probably benign Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Grhl2 T A 15: 37,336,314 V54D probably damaging Het
Hmcn1 T C 1: 150,675,991 I2621V probably benign Het
Hmcn1 T A 1: 150,677,376 E2521V possibly damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kifc1 A G 17: 33,884,587 probably null Het
Klk13 T A 7: 43,721,007 N31K possibly damaging Het
Klri1 T A 6: 129,697,384 H221L probably benign Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Med16 T C 10: 79,907,095 H14R possibly damaging Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mrgpra2a T A 7: 47,427,235 I92F probably benign Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Myo5a T A 9: 75,147,857 F441I probably damaging Het
Ndst4 T A 3: 125,438,682 L300* probably null Het
Nlgn2 G T 11: 69,827,310 D356E probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Oas1f G A 5: 120,856,439 C341Y possibly damaging Het
Olfm5 A T 7: 104,160,412 C111S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr523 A T 7: 140,176,683 I188L probably benign Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr821 C T 10: 130,034,318 Q231* probably null Het
Olfr876 A G 9: 37,803,946 I12V probably benign Het
Olfr919 T A 9: 38,698,204 H58L probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pde10a T C 17: 8,942,918 I477T possibly damaging Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb A T 18: 61,065,783 T338S probably benign Het
Pgghg A G 7: 140,943,347 M180V probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rangap1 T C 15: 81,706,503 T463A probably benign Het
Rap1gds1 T C 3: 139,050,556 I13V probably null Het
Rbak A T 5: 143,174,682 Y205* probably null Het
Reg3b A T 6: 78,371,814 K31M probably damaging Het
Rfpl4 A T 7: 5,115,534 Y12* probably null Het
Rnase6 A G 14: 51,130,432 N94D possibly damaging Het
Rtn4 T C 11: 29,736,464 L273P probably damaging Het
Ryr3 A C 2: 112,794,467 F2203V probably damaging Het
Sae1 A T 7: 16,368,565 D161E possibly damaging Het
Sema5a T C 15: 32,562,731 F296S possibly damaging Het
Sh3rf1 C A 8: 61,384,863 P814Q probably damaging Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc25a25 C T 2: 32,420,651 probably null Het
Slco4c1 T A 1: 96,867,929 M135L probably benign Het
Slfn1 A G 11: 83,121,753 I232V possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Srr A G 11: 74,908,716 V311A probably damaging Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Topors T C 4: 40,261,044 R747G unknown Het
Trank1 A T 9: 111,391,628 I2478F probably damaging Het
Trim69 A G 2: 122,167,684 N46D probably benign Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttn T C 2: 76,814,305 K4708R probably damaging Het
Unkl A G 17: 25,209,645 probably benign Het
Uros A T 7: 133,687,006 N257K probably benign Het
Usp25 A G 16: 77,076,371 Y439C probably damaging Het
Vmn2r8 A T 5: 108,799,286 D533E probably damaging Het
Vps13a A T 19: 16,725,631 Y653N probably damaging Het
Zfp358 T C 8: 3,495,742 V135A possibly damaging Het
Other mutations in Vgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0145:Vgf UTSW 5 137031482 unclassified probably benign
R1832:Vgf UTSW 5 137031299 missense possibly damaging 0.46
R2256:Vgf UTSW 5 137031547 unclassified probably benign
R3433:Vgf UTSW 5 137031019 missense probably benign 0.27
R4751:Vgf UTSW 5 137032401 missense probably damaging 0.99
R5304:Vgf UTSW 5 137032286 missense probably damaging 0.96
R6874:Vgf UTSW 5 137031532 unclassified probably benign
R6944:Vgf UTSW 5 137032352 missense probably damaging 0.99
R6969:Vgf UTSW 5 137031653 unclassified probably benign
R7499:Vgf UTSW 5 137032245 missense probably damaging 0.99
R7511:Vgf UTSW 5 137031391 missense unknown
R7791:Vgf UTSW 5 137032031 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCCAGTATCTGTTGCAGG -3'
(R):5'- ATGCTGACCACATCGTCTG -3'

Sequencing Primer
(F):5'- ATCTGTTGCAGGGCGGAG -3'
(R):5'- CAATGAGACTATCGATCGTCTGCG -3'
Posted On2015-05-19