Incidental Mutation 'R1960:Clec4n'
ID318029
Institutional Source Beutler Lab
Gene Symbol Clec4n
Ensembl Gene ENSMUSG00000023349
Gene NameC-type lectin domain family 4, member n
Synonymsdectin-2, Clecsf10, Nkcl
MMRRC Submission 039974-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1960 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location123229843-123247021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123230546 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 23 (V23E)
Ref Sequence ENSEMBL: ENSMUSP00000145023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024118] [ENSMUST00000112554] [ENSMUST00000117130] [ENSMUST00000151714] [ENSMUST00000205129]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024118
AA Change: V23E

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024118
Gene: ENSMUSG00000023349
AA Change: V23E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
CLECT 79 203 5.89e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112554
AA Change: V23E

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108173
Gene: ENSMUSG00000023349
AA Change: V23E

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
CLECT 45 169 5.89e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117130
SMART Domains Protein: ENSMUSP00000113733
Gene: ENSMUSG00000023349

DomainStartEndE-ValueType
CLECT 49 173 5.89e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144840
Predicted Effect possibly damaging
Transcript: ENSMUST00000151714
AA Change: V23E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120043
Gene: ENSMUSG00000023349
AA Change: V23E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205129
AA Change: V23E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145023
Gene: ENSMUSG00000023349
AA Change: V23E

DomainStartEndE-ValueType
Blast:CLECT 26 72 3e-13 BLAST
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane receptor with an extracellular C-type lectin-like domain fold. The extracellular portion binds structures with a high mannose content and has been shown to recognize several pathogens, including C. elegans, S. cerevisiae, M. tuberculosis, C. neoformans, and house dust mite. When stimulated, the encoded protein initiates signalling through the CARD9-Bcl10-Malt1 pathway, leading to the induction of cytokines. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele have defective responses to Candida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik C T 3: 145,938,221 P55S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arid1a A T 4: 133,753,090 H174Q possibly damaging Het
Btbd2 A G 10: 80,644,705 I358T probably benign Het
Camkk2 G A 5: 122,737,512 R492* probably null Het
Capn3 T C 2: 120,463,940 V23A probably benign Het
Carm1 T G 9: 21,580,310 V225G probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc60 C A 5: 116,146,184 M298I probably benign Het
Celsr3 C T 9: 108,845,817 P2801L probably benign Het
Cmtr2 T G 8: 110,221,750 L231V probably damaging Het
Csrnp3 T G 2: 66,023,019 V585G probably null Het
Ctnnd2 T C 15: 30,647,111 S318P probably damaging Het
Cubn A T 2: 13,340,017 probably null Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dnajc24 A G 2: 106,001,923 probably benign Het
Dner A T 1: 84,445,456 S475R probably damaging Het
Doxl2 C T 6: 48,975,753 T204I probably damaging Het
Dtnb T C 12: 3,781,190 L630P probably benign Het
Dysf T C 6: 84,073,903 F411L probably benign Het
Fam208a T C 14: 27,438,664 S128P probably damaging Het
Fam208a C T 14: 27,479,789 H1419Y possibly damaging Het
Fbxo18 G A 2: 11,757,528 A566V probably damaging Het
Fbxw19 G T 9: 109,485,936 T186K probably benign Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Grhl2 T A 15: 37,336,314 V54D probably damaging Het
Hmcn1 T C 1: 150,675,991 I2621V probably benign Het
Hmcn1 T A 1: 150,677,376 E2521V possibly damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kifc1 A G 17: 33,884,587 probably null Het
Klk13 T A 7: 43,721,007 N31K possibly damaging Het
Klri1 T A 6: 129,697,384 H221L probably benign Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Med16 T C 10: 79,907,095 H14R possibly damaging Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mrgpra2a T A 7: 47,427,235 I92F probably benign Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Myo5a T A 9: 75,147,857 F441I probably damaging Het
Ndst4 T A 3: 125,438,682 L300* probably null Het
Nlgn2 G T 11: 69,827,310 D356E probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Oas1f G A 5: 120,856,439 C341Y possibly damaging Het
Olfm5 A T 7: 104,160,412 C111S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr523 A T 7: 140,176,683 I188L probably benign Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr821 C T 10: 130,034,318 Q231* probably null Het
Olfr876 A G 9: 37,803,946 I12V probably benign Het
Olfr919 T A 9: 38,698,204 H58L probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pde10a T C 17: 8,942,918 I477T possibly damaging Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb A T 18: 61,065,783 T338S probably benign Het
Pgghg A G 7: 140,943,347 M180V probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rangap1 T C 15: 81,706,503 T463A probably benign Het
Rap1gds1 T C 3: 139,050,556 I13V probably null Het
Rbak A T 5: 143,174,682 Y205* probably null Het
Reg3b A T 6: 78,371,814 K31M probably damaging Het
Rfpl4 A T 7: 5,115,534 Y12* probably null Het
Rnase6 A G 14: 51,130,432 N94D possibly damaging Het
Rtn4 T C 11: 29,736,464 L273P probably damaging Het
Ryr3 A C 2: 112,794,467 F2203V probably damaging Het
Sae1 A T 7: 16,368,565 D161E possibly damaging Het
Sema5a T C 15: 32,562,731 F296S possibly damaging Het
Sh3rf1 C A 8: 61,384,863 P814Q probably damaging Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc25a25 C T 2: 32,420,651 probably null Het
Slco4c1 T A 1: 96,867,929 M135L probably benign Het
Slfn1 A G 11: 83,121,753 I232V possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Srr A G 11: 74,908,716 V311A probably damaging Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Topors T C 4: 40,261,044 R747G unknown Het
Trank1 A T 9: 111,391,628 I2478F probably damaging Het
Trim69 A G 2: 122,167,684 N46D probably benign Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttn T C 2: 76,814,305 K4708R probably damaging Het
Unkl A G 17: 25,209,645 probably benign Het
Uros A T 7: 133,687,006 N257K probably benign Het
Usp25 A G 16: 77,076,371 Y439C probably damaging Het
Vgf A G 5: 137,032,175 probably benign Het
Vmn2r8 A T 5: 108,799,286 D533E probably damaging Het
Vps13a A T 19: 16,725,631 Y653N probably damaging Het
Zfp358 T C 8: 3,495,742 V135A possibly damaging Het
Other mutations in Clec4n
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Clec4n APN 6 123244474 intron probably benign
IGL02248:Clec4n APN 6 123230568 missense probably damaging 0.99
IGL03181:Clec4n APN 6 123230515 missense possibly damaging 0.90
IGL03293:Clec4n APN 6 123232146 missense probably benign 0.10
P4717OSA:Clec4n UTSW 6 123244540 missense probably damaging 0.97
P4748:Clec4n UTSW 6 123244540 missense probably damaging 0.97
R1137:Clec4n UTSW 6 123246567 missense possibly damaging 0.80
R1445:Clec4n UTSW 6 123235516 missense probably benign 0.01
R1538:Clec4n UTSW 6 123230033 missense possibly damaging 0.66
R1804:Clec4n UTSW 6 123230022 missense possibly damaging 0.46
R2046:Clec4n UTSW 6 123246504 missense probably benign 0.00
R4097:Clec4n UTSW 6 123230741 missense possibly damaging 0.66
R4657:Clec4n UTSW 6 123232196 critical splice donor site probably null
R4967:Clec4n UTSW 6 123232107 missense probably benign 0.41
R5471:Clec4n UTSW 6 123232186 missense probably benign 0.06
R6703:Clec4n UTSW 6 123235594 missense probably null 1.00
R7411:Clec4n UTSW 6 123232186 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGTCATATTATAGGGCTGTGACAG -3'
(R):5'- GCATTACCTGTGAAGTCAGACC -3'

Sequencing Primer
(F):5'- TGTGACAGCTTTTTCCTACTTTAAG -3'
(R):5'- GCCATCCTGATCTATGGAGAG -3'
Posted On2015-05-19