Incidental Mutation 'R1960:Sae1'
ID 318033
Institutional Source Beutler Lab
Gene Symbol Sae1
Ensembl Gene ENSMUSG00000052833
Gene Name SUMO1 activating enzyme subunit 1
Synonyms 2400010M20Rik, SUMO-1 activating enzyme subunit 1, HSPC140, AOS1, Uble1a, 2610044L12Rik, D7Ertd177e
MMRRC Submission 039974-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R1960 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 16054159-16121731 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 16102490 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 161 (D161E)
Ref Sequence ENSEMBL: ENSMUSP00000147771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094815] [ENSMUST00000210999] [ENSMUST00000211741]
AlphaFold Q9R1T2
Predicted Effect possibly damaging
Transcript: ENSMUST00000094815
AA Change: D161E

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092409
Gene: ENSMUSG00000052833
AA Change: D161E

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:ThiF 23 344 4.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209749
Predicted Effect possibly damaging
Transcript: ENSMUST00000210999
AA Change: D161E

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211741
AA Change: D161E

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (95/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik C T 3: 145,643,976 (GRCm39) P55S probably damaging Het
Adgre4 T C 17: 56,098,497 (GRCm39) S136P probably benign Het
Aoc1l1 C T 6: 48,952,687 (GRCm39) T204I probably damaging Het
Arap1 C A 7: 101,022,222 (GRCm39) A8E probably damaging Het
Arid1a A T 4: 133,480,401 (GRCm39) H174Q possibly damaging Het
Btbd2 A G 10: 80,480,539 (GRCm39) I358T probably benign Het
Camkk2 G A 5: 122,875,575 (GRCm39) R492* probably null Het
Capn3 T C 2: 120,294,421 (GRCm39) V23A probably benign Het
Carm1 T G 9: 21,491,606 (GRCm39) V225G probably benign Het
Ccdc113 T A 8: 96,267,459 (GRCm39) N141K probably benign Het
Ccdc60 C A 5: 116,284,243 (GRCm39) M298I probably benign Het
Celsr3 C T 9: 108,723,016 (GRCm39) P2801L probably benign Het
Clec4n T A 6: 123,207,505 (GRCm39) V23E probably damaging Het
Cmtr2 T G 8: 110,948,382 (GRCm39) L231V probably damaging Het
Csrnp3 T G 2: 65,853,363 (GRCm39) V585G probably null Het
Ctnnd2 T C 15: 30,647,257 (GRCm39) S318P probably damaging Het
Cubn A T 2: 13,344,828 (GRCm39) probably null Het
Dgkd C A 1: 87,857,549 (GRCm39) P754T possibly damaging Het
Dnah7a A G 1: 53,724,142 (GRCm39) S108P probably benign Het
Dnajc24 A G 2: 105,832,268 (GRCm39) probably benign Het
Dner A T 1: 84,423,177 (GRCm39) S475R probably damaging Het
Dtnb T C 12: 3,831,190 (GRCm39) L630P probably benign Het
Dysf T C 6: 84,050,885 (GRCm39) F411L probably benign Het
Fbh1 G A 2: 11,762,339 (GRCm39) A566V probably damaging Het
Fbxw19 G T 9: 109,315,004 (GRCm39) T186K probably benign Het
Flacc1 A T 1: 58,698,437 (GRCm39) V327D possibly damaging Het
Gm4825 A G 15: 85,395,245 (GRCm39) noncoding transcript Het
Grhl2 T A 15: 37,336,558 (GRCm39) V54D probably damaging Het
Hmcn1 T C 1: 150,551,742 (GRCm39) I2621V probably benign Het
Hmcn1 T A 1: 150,553,127 (GRCm39) E2521V possibly damaging Het
Kcng1 A G 2: 168,104,904 (GRCm39) V314A probably benign Het
Kif13a G A 13: 47,018,314 (GRCm39) probably benign Het
Kif21a G A 15: 90,855,051 (GRCm39) A703V probably damaging Het
Kifc1 A G 17: 34,103,561 (GRCm39) probably null Het
Klk13 T A 7: 43,370,431 (GRCm39) N31K possibly damaging Het
Klri1 T A 6: 129,674,347 (GRCm39) H221L probably benign Het
Ltbp4 G A 7: 27,028,443 (GRCm39) P273L unknown Het
Med16 T C 10: 79,742,929 (GRCm39) H14R possibly damaging Het
Mpeg1 G A 19: 12,440,275 (GRCm39) V578M probably damaging Het
Mrgpra2a T A 7: 47,076,983 (GRCm39) I92F probably benign Het
Muc5b T C 7: 141,416,374 (GRCm39) C3107R possibly damaging Het
Myo5a T A 9: 75,055,139 (GRCm39) F441I probably damaging Het
Ndst4 T A 3: 125,232,331 (GRCm39) L300* probably null Het
Nlgn2 G T 11: 69,718,136 (GRCm39) D356E probably damaging Het
Nlrp2 T C 7: 5,330,737 (GRCm39) E553G probably damaging Het
Oas1f G A 5: 120,994,502 (GRCm39) C341Y possibly damaging Het
Olfm5 A T 7: 103,809,619 (GRCm39) C111S possibly damaging Het
Oplah G A 15: 76,181,664 (GRCm39) T1119I probably damaging Het
Or2ag15 T C 7: 106,340,601 (GRCm39) E180G probably damaging Het
Or5d46 T C 2: 88,170,545 (GRCm39) L212P probably damaging Het
Or6c74 C T 10: 129,870,187 (GRCm39) Q231* probably null Het
Or6f2 A T 7: 139,756,596 (GRCm39) I188L probably benign Het
Or8b12c A G 9: 37,715,242 (GRCm39) I12V probably benign Het
Or8g51 T A 9: 38,609,500 (GRCm39) H58L probably benign Het
Pde10a T C 17: 9,161,750 (GRCm39) I477T possibly damaging Het
Pde4b A G 4: 102,454,657 (GRCm39) E108G probably damaging Het
Pdgfrb A T 18: 61,198,855 (GRCm39) T338S probably benign Het
Pgghg A G 7: 140,523,260 (GRCm39) M180V probably benign Het
Phactr4 G A 4: 132,104,559 (GRCm39) T256I probably benign Het
Pot1b A T 17: 55,969,531 (GRCm39) Y546N probably damaging Het
Rangap1 T C 15: 81,590,704 (GRCm39) T463A probably benign Het
Rap1gds1 T C 3: 138,756,317 (GRCm39) I13V probably null Het
Rbak A T 5: 143,160,437 (GRCm39) Y205* probably null Het
Reg3b A T 6: 78,348,797 (GRCm39) K31M probably damaging Het
Rfpl4 A T 7: 5,118,533 (GRCm39) Y12* probably null Het
Rnase6 A G 14: 51,367,889 (GRCm39) N94D possibly damaging Het
Rtn4 T C 11: 29,686,464 (GRCm39) L273P probably damaging Het
Ryr3 A C 2: 112,624,812 (GRCm39) F2203V probably damaging Het
Sema5a T C 15: 32,562,877 (GRCm39) F296S possibly damaging Het
Sh3rf1 C A 8: 61,837,897 (GRCm39) P814Q probably damaging Het
Slc22a29 C A 19: 8,146,557 (GRCm39) R415M probably benign Het
Slc25a25 C T 2: 32,310,663 (GRCm39) probably null Het
Slco4c1 T A 1: 96,795,654 (GRCm39) M135L probably benign Het
Slfn1 A G 11: 83,012,579 (GRCm39) I232V possibly damaging Het
Slitrk1 T A 14: 109,149,622 (GRCm39) N363I probably damaging Het
Srr A G 11: 74,799,542 (GRCm39) V311A probably damaging Het
Tasor T C 14: 27,160,621 (GRCm39) S128P probably damaging Het
Tasor C T 14: 27,201,746 (GRCm39) H1419Y possibly damaging Het
Tenm1 T C X: 41,916,078 (GRCm39) D402G probably benign Het
Topors T C 4: 40,261,044 (GRCm39) R747G unknown Het
Trank1 A T 9: 111,220,696 (GRCm39) I2478F probably damaging Het
Trim69 A G 2: 121,998,165 (GRCm39) N46D probably benign Het
Trpm1 T A 7: 63,879,978 (GRCm39) L661Q probably damaging Het
Ttbk1 A C 17: 46,791,150 (GRCm39) F45V probably damaging Het
Ttn T C 2: 76,644,649 (GRCm39) K4708R probably damaging Het
Unkl A G 17: 25,428,619 (GRCm39) probably benign Het
Uros A T 7: 133,288,735 (GRCm39) N257K probably benign Het
Usp25 A G 16: 76,873,259 (GRCm39) Y439C probably damaging Het
Vgf A G 5: 137,061,029 (GRCm39) probably benign Het
Vmn2r8 A T 5: 108,947,152 (GRCm39) D533E probably damaging Het
Vps13a A T 19: 16,702,995 (GRCm39) Y653N probably damaging Het
Zfp358 T C 8: 3,545,742 (GRCm39) V135A possibly damaging Het
Other mutations in Sae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Sae1 APN 7 16,064,581 (GRCm39) missense possibly damaging 0.94
IGL02672:Sae1 APN 7 16,104,273 (GRCm39) missense probably damaging 1.00
IGL02881:Sae1 APN 7 16,093,043 (GRCm39) missense probably damaging 1.00
R0255:Sae1 UTSW 7 16,104,247 (GRCm39) nonsense probably null
R0667:Sae1 UTSW 7 16,102,457 (GRCm39) missense probably damaging 1.00
R1374:Sae1 UTSW 7 16,112,333 (GRCm39) missense probably damaging 0.97
R1585:Sae1 UTSW 7 16,064,537 (GRCm39) critical splice donor site probably null
R2278:Sae1 UTSW 7 16,104,291 (GRCm39) missense probably damaging 1.00
R5513:Sae1 UTSW 7 16,100,781 (GRCm39) missense probably benign 0.00
R5677:Sae1 UTSW 7 16,104,387 (GRCm39) critical splice acceptor site probably null
R6694:Sae1 UTSW 7 16,102,461 (GRCm39) missense probably damaging 1.00
R6975:Sae1 UTSW 7 16,070,712 (GRCm39) missense probably damaging 0.99
R7307:Sae1 UTSW 7 16,102,469 (GRCm39) nonsense probably null
R7914:Sae1 UTSW 7 16,121,648 (GRCm39) missense unknown
R8437:Sae1 UTSW 7 16,104,279 (GRCm39) missense probably damaging 1.00
R9076:Sae1 UTSW 7 16,070,668 (GRCm39) missense probably benign
Z1177:Sae1 UTSW 7 16,061,796 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCTTGTCTGAGAATGTTCTGAAG -3'
(R):5'- GCACCCAAGAACCTGTTATTC -3'

Sequencing Primer
(F):5'- ACTCAACTGTGGAACGCT -3'
(R):5'- GAAACTGGTCTTAAGCCTGCCAG -3'
Posted On 2015-05-19