Incidental Mutation 'R1960:Med16'
ID 318057
Institutional Source Beutler Lab
Gene Symbol Med16
Ensembl Gene ENSMUSG00000013833
Gene Name mediator complex subunit 16
Synonyms Trap95, 95kDa, Thrap5
MMRRC Submission 039974-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1960 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 79894708-79908923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 79907095 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 14 (H14R)
Ref Sequence ENSEMBL: ENSMUSP00000126729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045628] [ENSMUST00000105378] [ENSMUST00000164705] [ENSMUST00000165684] [ENSMUST00000166964] [ENSMUST00000170409] [ENSMUST00000171416] [ENSMUST00000181321]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045628
SMART Domains Protein: ENSMUSP00000044570
Gene: ENSMUSG00000035781

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 1.2e-35 PFAM
Pfam:R3H 181 244 7.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105378
AA Change: H98R

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101017
Gene: ENSMUSG00000013833
AA Change: H98R

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
WD40 94 133 1.05e-7 SMART
Blast:WD40 143 169 4e-8 BLAST
low complexity region 206 217 N/A INTRINSIC
WD40 226 267 1.53e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163125
Predicted Effect probably benign
Transcript: ENSMUST00000164705
AA Change: H14R

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000129229
Gene: ENSMUSG00000013833
AA Change: H14R

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 172 6.5e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165684
AA Change: H99R

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129375
Gene: ENSMUSG00000013833
AA Change: H99R

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
WD40 95 134 1.05e-7 SMART
Blast:WD40 144 170 4e-8 BLAST
low complexity region 207 218 N/A INTRINSIC
WD40 227 268 1.53e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166964
AA Change: H63R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000128463
Gene: ENSMUSG00000013833
AA Change: H63R

DomainStartEndE-ValueType
WD40 59 98 1.05e-7 SMART
Pfam:Med16 108 162 2.2e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170409
AA Change: H14R

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126729
Gene: ENSMUSG00000013833
AA Change: H14R

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 105 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171416
SMART Domains Protein: ENSMUSP00000132266
Gene: ENSMUSG00000035781

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 4.9e-39 PFAM
Pfam:R3H 183 243 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178620
Predicted Effect probably benign
Transcript: ENSMUST00000181321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219358
Meta Mutation Damage Score 0.0896 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (95/95)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik C T 3: 145,938,221 P55S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Als2cr12 A T 1: 58,659,278 V327D possibly damaging Het
Arap1 C A 7: 101,373,015 A8E probably damaging Het
Arid1a A T 4: 133,753,090 H174Q possibly damaging Het
Btbd2 A G 10: 80,644,705 I358T probably benign Het
Camkk2 G A 5: 122,737,512 R492* probably null Het
Capn3 T C 2: 120,463,940 V23A probably benign Het
Carm1 T G 9: 21,580,310 V225G probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc60 C A 5: 116,146,184 M298I probably benign Het
Celsr3 C T 9: 108,845,817 P2801L probably benign Het
Clec4n T A 6: 123,230,546 V23E probably damaging Het
Cmtr2 T G 8: 110,221,750 L231V probably damaging Het
Csrnp3 T G 2: 66,023,019 V585G probably null Het
Ctnnd2 T C 15: 30,647,111 S318P probably damaging Het
Cubn A T 2: 13,340,017 probably null Het
Dgkd C A 1: 87,929,827 P754T possibly damaging Het
Dnah7a A G 1: 53,684,983 S108P probably benign Het
Dnajc24 A G 2: 106,001,923 probably benign Het
Dner A T 1: 84,445,456 S475R probably damaging Het
Doxl2 C T 6: 48,975,753 T204I probably damaging Het
Dtnb T C 12: 3,781,190 L630P probably benign Het
Dysf T C 6: 84,073,903 F411L probably benign Het
Fam208a T C 14: 27,438,664 S128P probably damaging Het
Fam208a C T 14: 27,479,789 H1419Y possibly damaging Het
Fbxo18 G A 2: 11,757,528 A566V probably damaging Het
Fbxw19 G T 9: 109,485,936 T186K probably benign Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Grhl2 T A 15: 37,336,314 V54D probably damaging Het
Hmcn1 T C 1: 150,675,991 I2621V probably benign Het
Hmcn1 T A 1: 150,677,376 E2521V possibly damaging Het
Kcng1 A G 2: 168,262,984 V314A probably benign Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kifc1 A G 17: 33,884,587 probably null Het
Klk13 T A 7: 43,721,007 N31K possibly damaging Het
Klri1 T A 6: 129,697,384 H221L probably benign Het
Ltbp4 G A 7: 27,329,018 P273L unknown Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Mrgpra2a T A 7: 47,427,235 I92F probably benign Het
Muc5b T C 7: 141,862,637 C3107R possibly damaging Het
Myo5a T A 9: 75,147,857 F441I probably damaging Het
Ndst4 T A 3: 125,438,682 L300* probably null Het
Nlgn2 G T 11: 69,827,310 D356E probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Oas1f G A 5: 120,856,439 C341Y possibly damaging Het
Olfm5 A T 7: 104,160,412 C111S possibly damaging Het
Olfr1176 T C 2: 88,340,201 L212P probably damaging Het
Olfr523 A T 7: 140,176,683 I188L probably benign Het
Olfr697 T C 7: 106,741,394 E180G probably damaging Het
Olfr821 C T 10: 130,034,318 Q231* probably null Het
Olfr876 A G 9: 37,803,946 I12V probably benign Het
Olfr919 T A 9: 38,698,204 H58L probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Pde10a T C 17: 8,942,918 I477T possibly damaging Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb A T 18: 61,065,783 T338S probably benign Het
Pgghg A G 7: 140,943,347 M180V probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rangap1 T C 15: 81,706,503 T463A probably benign Het
Rap1gds1 T C 3: 139,050,556 I13V probably null Het
Rbak A T 5: 143,174,682 Y205* probably null Het
Reg3b A T 6: 78,371,814 K31M probably damaging Het
Rfpl4 A T 7: 5,115,534 Y12* probably null Het
Rnase6 A G 14: 51,130,432 N94D possibly damaging Het
Rtn4 T C 11: 29,736,464 L273P probably damaging Het
Ryr3 A C 2: 112,794,467 F2203V probably damaging Het
Sae1 A T 7: 16,368,565 D161E possibly damaging Het
Sema5a T C 15: 32,562,731 F296S possibly damaging Het
Sh3rf1 C A 8: 61,384,863 P814Q probably damaging Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc25a25 C T 2: 32,420,651 probably null Het
Slco4c1 T A 1: 96,867,929 M135L probably benign Het
Slfn1 A G 11: 83,121,753 I232V possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Srr A G 11: 74,908,716 V311A probably damaging Het
Tenm1 T C X: 42,827,201 D402G probably benign Het
Topors T C 4: 40,261,044 R747G unknown Het
Trank1 A T 9: 111,391,628 I2478F probably damaging Het
Trim69 A G 2: 122,167,684 N46D probably benign Het
Trpm1 T A 7: 64,230,230 L661Q probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttn T C 2: 76,814,305 K4708R probably damaging Het
Unkl A G 17: 25,209,645 probably benign Het
Uros A T 7: 133,687,006 N257K probably benign Het
Usp25 A G 16: 77,076,371 Y439C probably damaging Het
Vgf A G 5: 137,032,175 probably benign Het
Vmn2r8 A T 5: 108,799,286 D533E probably damaging Het
Vps13a A T 19: 16,725,631 Y653N probably damaging Het
Zfp358 T C 8: 3,495,742 V135A possibly damaging Het
Other mutations in Med16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Med16 APN 10 79907625 start codon destroyed probably null 0.62
IGL02328:Med16 APN 10 79907542 missense probably damaging 1.00
IGL03123:Med16 APN 10 79896833 missense probably damaging 1.00
R0139:Med16 UTSW 10 79896801 missense probably benign 0.17
R0254:Med16 UTSW 10 79900200 missense possibly damaging 0.94
R1458:Med16 UTSW 10 79907478 unclassified probably benign
R1483:Med16 UTSW 10 79903100 missense possibly damaging 0.88
R1524:Med16 UTSW 10 79898316 missense probably damaging 1.00
R1612:Med16 UTSW 10 79899245 missense probably damaging 1.00
R1700:Med16 UTSW 10 79899335 missense probably benign 0.10
R1900:Med16 UTSW 10 79898931 missense probably damaging 1.00
R2120:Med16 UTSW 10 79903082 missense possibly damaging 0.63
R2895:Med16 UTSW 10 79903171 splice site probably null
R4419:Med16 UTSW 10 79898382 missense probably benign
R4794:Med16 UTSW 10 79900117 missense probably damaging 1.00
R4970:Med16 UTSW 10 79907037 critical splice donor site probably null
R4975:Med16 UTSW 10 79903005 missense possibly damaging 0.93
R5724:Med16 UTSW 10 79895409 missense probably damaging 1.00
R5926:Med16 UTSW 10 79902528 missense probably damaging 0.99
R6185:Med16 UTSW 10 79896363 missense probably damaging 1.00
R7097:Med16 UTSW 10 79903343 missense probably damaging 1.00
R7346:Med16 UTSW 10 79908816 critical splice donor site probably null
R7350:Med16 UTSW 10 79903197 missense probably damaging 1.00
R7808:Med16 UTSW 10 79898418 missense probably damaging 1.00
R7877:Med16 UTSW 10 79898372 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCATCAGCATCAGCAGACAG -3'
(R):5'- TGCTCACCATCTTCCAACAATG -3'

Sequencing Primer
(F):5'- CATCAGCAGACAGTAGCCGG -3'
(R):5'- CAATGTTAAGACATGTGGCTGCAC -3'
Posted On 2015-05-19