Incidental Mutation 'R2208:Phldb1'
ID 318101
Institutional Source Beutler Lab
Gene Symbol Phldb1
Ensembl Gene ENSMUSG00000048537
Gene Name pleckstrin homology like domain, family B, member 1
Synonyms D330037A14Rik, LL5A
MMRRC Submission 040210-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R2208 (G1)
Quality Score 40
Status Validated
Chromosome 9
Chromosomal Location 44597601-44646495 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 44607428 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 1192 (R1192Q)
Ref Sequence ENSEMBL: ENSMUSP00000034611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034611] [ENSMUST00000123310] [ENSMUST00000134465] [ENSMUST00000138356] [ENSMUST00000147495] [ENSMUST00000156918] [ENSMUST00000144251] [ENSMUST00000135436] [ENSMUST00000154723]
AlphaFold Q6PDH0
Predicted Effect probably damaging
Transcript: ENSMUST00000034611
AA Change: R1192Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034611
Gene: ENSMUSG00000048537
AA Change: R1192Q

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5.01e-5 PROSPERO
internal_repeat_1 401 449 5.01e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1366 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123310
SMART Domains Protein: ENSMUSP00000122374
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
low complexity region 58 79 N/A INTRINSIC
low complexity region 137 151 N/A INTRINSIC
low complexity region 185 193 N/A INTRINSIC
coiled coil region 232 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128326
AA Change: R652Q

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119966
Gene: ENSMUSG00000048537
AA Change: R652Q

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 187 200 N/A INTRINSIC
coiled coil region 207 290 N/A INTRINSIC
low complexity region 312 322 N/A INTRINSIC
coiled coil region 357 396 N/A INTRINSIC
low complexity region 422 443 N/A INTRINSIC
low complexity region 493 506 N/A INTRINSIC
low complexity region 516 530 N/A INTRINSIC
low complexity region 564 572 N/A INTRINSIC
coiled coil region 610 679 N/A INTRINSIC
PH 723 827 1.31e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133312
Predicted Effect probably damaging
Transcript: ENSMUST00000134465
AA Change: R1145Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117395
Gene: ENSMUSG00000048537
AA Change: R1145Q

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 3e-10 PDB
Blast:FHA 63 110 8e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 6.75e-5 PROSPERO
internal_repeat_1 401 449 6.75e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 929 950 N/A INTRINSIC
low complexity region 1008 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
coiled coil region 1103 1172 N/A INTRINSIC
PH 1215 1319 1.31e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000138356
AA Change: R1259Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120208
Gene: ENSMUSG00000048537
AA Change: R1259Q

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 4.93e-5 PROSPERO
internal_repeat_1 401 449 4.93e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 931 948 N/A INTRINSIC
low complexity region 999 1017 N/A INTRINSIC
low complexity region 1032 1053 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
low complexity region 1159 1167 N/A INTRINSIC
coiled coil region 1206 1286 N/A INTRINSIC
PH 1329 1444 6.01e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000147495
AA Change: R1192Q

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122661
Gene: ENSMUSG00000048537
AA Change: R1192Q

DomainStartEndE-ValueType
PDB:2EH0|A 40 139 4e-10 PDB
Blast:FHA 63 110 6e-21 BLAST
low complexity region 181 192 N/A INTRINSIC
low complexity region 252 273 N/A INTRINSIC
low complexity region 296 316 N/A INTRINSIC
internal_repeat_1 321 354 5e-5 PROSPERO
internal_repeat_1 401 449 5e-5 PROSPERO
low complexity region 459 477 N/A INTRINSIC
low complexity region 590 617 N/A INTRINSIC
low complexity region 694 707 N/A INTRINSIC
coiled coil region 715 798 N/A INTRINSIC
low complexity region 819 829 N/A INTRINSIC
coiled coil region 865 904 N/A INTRINSIC
low complexity region 943 961 N/A INTRINSIC
low complexity region 976 997 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
low complexity region 1103 1111 N/A INTRINSIC
coiled coil region 1150 1219 N/A INTRINSIC
PH 1262 1377 6.01e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000148344
AA Change: R951Q

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121809
Gene: ENSMUSG00000048537
AA Change: R951Q

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 41 61 N/A INTRINSIC
internal_repeat_1 66 99 6.7e-6 PROSPERO
internal_repeat_1 146 194 6.7e-6 PROSPERO
low complexity region 204 222 N/A INTRINSIC
low complexity region 335 362 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
coiled coil region 459 542 N/A INTRINSIC
low complexity region 564 574 N/A INTRINSIC
coiled coil region 609 648 N/A INTRINSIC
low complexity region 688 706 N/A INTRINSIC
low complexity region 721 742 N/A INTRINSIC
low complexity region 792 805 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
low complexity region 863 871 N/A INTRINSIC
coiled coil region 909 978 N/A INTRINSIC
PH 1022 1126 1.31e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156918
AA Change: R462Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120092
Gene: ENSMUSG00000048537
AA Change: R462Q

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
low complexity region 136 146 N/A INTRINSIC
coiled coil region 182 221 N/A INTRINSIC
low complexity region 246 267 N/A INTRINSIC
low complexity region 325 339 N/A INTRINSIC
low complexity region 373 381 N/A INTRINSIC
coiled coil region 420 489 N/A INTRINSIC
PH 532 636 1.31e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144251
AA Change: R505Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114773
Gene: ENSMUSG00000048537
AA Change: R505Q

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
coiled coil region 32 115 N/A INTRINSIC
coiled coil region 146 174 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
coiled coil region 225 264 N/A INTRINSIC
low complexity region 289 310 N/A INTRINSIC
low complexity region 368 382 N/A INTRINSIC
low complexity region 416 424 N/A INTRINSIC
coiled coil region 463 532 N/A INTRINSIC
PH 575 679 1.31e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135436
AA Change: R316Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120023
Gene: ENSMUSG00000048537
AA Change: R316Q

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
coiled coil region 274 343 N/A INTRINSIC
PH 386 490 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154723
SMART Domains Protein: ENSMUSP00000116987
Gene: ENSMUSG00000048537

DomainStartEndE-ValueType
coiled coil region 39 67 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
coiled coil region 118 157 N/A INTRINSIC
low complexity region 197 212 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 8,995,096 (GRCm39) V5460A probably benign Het
Bco2 A G 9: 50,444,755 (GRCm39) V517A probably damaging Het
Brca2 T A 5: 150,455,809 (GRCm39) D183E probably damaging Het
Ccdc142 T C 6: 83,084,941 (GRCm39) probably null Het
Ccdc39 A G 3: 33,895,327 (GRCm39) L34P probably damaging Het
Cdc42bpb T A 12: 111,302,463 (GRCm39) H198L probably damaging Het
Cdc73 T A 1: 143,485,120 (GRCm39) E516V probably damaging Het
Cep170b T A 12: 112,705,419 (GRCm39) L1059Q probably benign Het
Chrm1 T C 19: 8,655,463 (GRCm39) L56P probably damaging Het
Clec4d T A 6: 123,242,314 (GRCm39) V22D probably damaging Het
Cplane1 T A 15: 8,223,887 (GRCm39) N883K probably benign Het
Cyp2c39 T C 19: 39,549,405 (GRCm39) Y308H possibly damaging Het
Cyp2d12 T C 15: 82,441,137 (GRCm39) L141P probably damaging Het
Cyp4x1 G T 4: 114,983,791 (GRCm39) Q85K probably benign Het
Dpysl5 G A 5: 30,948,941 (GRCm39) D399N probably damaging Het
Enpp7 T C 11: 118,879,588 (GRCm39) probably benign Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fitm2 T A 2: 163,314,604 (GRCm39) probably benign Het
Gng10 T A 4: 59,035,314 (GRCm39) I26N possibly damaging Het
Gpr33 C T 12: 52,070,236 (GRCm39) V268I probably benign Het
Hmcn2 G A 2: 31,270,309 (GRCm39) C1182Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Krt36 C T 11: 99,993,765 (GRCm39) V358M probably damaging Het
Lmod3 T C 6: 97,224,838 (GRCm39) I328V probably benign Het
Lrp8 T C 4: 107,712,987 (GRCm39) V580A probably damaging Het
Masp2 T C 4: 148,698,872 (GRCm39) I651T probably damaging Het
Mnd1 C A 3: 84,041,416 (GRCm39) C62F probably benign Het
Msi2 A T 11: 88,480,934 (GRCm39) S118T probably damaging Het
Muc19 T C 15: 91,755,747 (GRCm39) noncoding transcript Het
Nabp1 G A 1: 51,516,773 (GRCm39) R32* probably null Het
Nfix CAAAAA CAAAA 8: 85,442,876 (GRCm39) probably null Het
Nup88 T C 11: 70,856,545 (GRCm39) D196G probably damaging Het
Or11h4b T C 14: 50,919,020 (GRCm39) I24V probably benign Het
Pax1 T A 2: 147,207,722 (GRCm39) I198N probably damaging Het
Pde3a A G 6: 141,196,073 (GRCm39) E253G probably damaging Het
Pianp C A 6: 124,976,602 (GRCm39) P137Q probably damaging Het
Prdm15 A C 16: 97,600,464 (GRCm39) probably null Het
Ptprf A T 4: 118,126,369 (GRCm39) probably benign Het
Rfx7 A G 9: 72,525,246 (GRCm39) D812G probably benign Het
Rgs22 T C 15: 36,050,378 (GRCm39) T691A probably benign Het
Rundc3a A T 11: 102,292,914 (GRCm39) S436C probably damaging Het
Sntb1 T C 15: 55,769,714 (GRCm39) T92A possibly damaging Het
Tars3 T C 7: 65,332,596 (GRCm39) S566P probably damaging Het
Tbc1d32 A T 10: 56,026,888 (GRCm39) probably null Het
Tep1 T C 14: 51,104,321 (GRCm39) Q191R probably benign Het
Tmc2 C A 2: 130,056,483 (GRCm39) probably null Het
Tns1 A C 1: 74,118,399 (GRCm39) I77S probably damaging Het
Trpd52l3 T C 19: 29,981,646 (GRCm39) W134R probably damaging Het
Vmn2r15 A C 5: 109,445,309 (GRCm39) N38K possibly damaging Het
Wdr90 A T 17: 26,079,362 (GRCm39) D257E probably damaging Het
Zbtb9 T C 17: 27,193,098 (GRCm39) C168R possibly damaging Het
Zfp1004 T A 2: 150,035,065 (GRCm39) V462E probably benign Het
Other mutations in Phldb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Phldb1 APN 9 44,622,443 (GRCm39) critical splice donor site probably null
IGL01089:Phldb1 APN 9 44,619,184 (GRCm39) nonsense probably null
IGL01374:Phldb1 APN 9 44,607,464 (GRCm39) missense probably damaging 0.98
IGL01654:Phldb1 APN 9 44,629,654 (GRCm39) splice site probably null
IGL02148:Phldb1 APN 9 44,607,369 (GRCm39) missense probably damaging 0.99
IGL02408:Phldb1 APN 9 44,627,203 (GRCm39) missense possibly damaging 0.50
IGL02429:Phldb1 APN 9 44,612,247 (GRCm39) missense probably damaging 1.00
IGL02440:Phldb1 APN 9 44,626,700 (GRCm39) missense probably damaging 0.99
IGL02457:Phldb1 APN 9 44,627,771 (GRCm39) missense probably benign 0.00
IGL02471:Phldb1 APN 9 44,622,530 (GRCm39) missense probably damaging 1.00
IGL02506:Phldb1 APN 9 44,622,223 (GRCm39) missense probably benign 0.00
IGL03335:Phldb1 APN 9 44,639,366 (GRCm39) missense possibly damaging 0.95
PIT4515001:Phldb1 UTSW 9 44,627,257 (GRCm39) missense probably benign 0.00
R0070:Phldb1 UTSW 9 44,619,201 (GRCm39) missense probably damaging 1.00
R0117:Phldb1 UTSW 9 44,623,003 (GRCm39) start codon destroyed probably null
R0344:Phldb1 UTSW 9 44,612,964 (GRCm39) missense probably benign 0.14
R0364:Phldb1 UTSW 9 44,610,632 (GRCm39) splice site probably benign
R0622:Phldb1 UTSW 9 44,627,149 (GRCm39) missense probably damaging 1.00
R0737:Phldb1 UTSW 9 44,610,933 (GRCm39) missense possibly damaging 0.92
R1449:Phldb1 UTSW 9 44,627,930 (GRCm39) missense probably benign 0.17
R1498:Phldb1 UTSW 9 44,612,915 (GRCm39) missense possibly damaging 0.70
R1633:Phldb1 UTSW 9 44,629,619 (GRCm39) missense probably damaging 1.00
R1647:Phldb1 UTSW 9 44,626,730 (GRCm39) missense probably damaging 1.00
R1692:Phldb1 UTSW 9 44,626,717 (GRCm39) missense probably damaging 1.00
R1749:Phldb1 UTSW 9 44,627,045 (GRCm39) missense probably damaging 1.00
R1797:Phldb1 UTSW 9 44,627,842 (GRCm39) missense probably damaging 0.99
R2012:Phldb1 UTSW 9 44,639,333 (GRCm39) missense possibly damaging 0.67
R2078:Phldb1 UTSW 9 44,619,276 (GRCm39) missense probably damaging 1.00
R2567:Phldb1 UTSW 9 44,637,322 (GRCm39) missense probably damaging 0.99
R2696:Phldb1 UTSW 9 44,629,585 (GRCm39) missense probably damaging 1.00
R3705:Phldb1 UTSW 9 44,605,691 (GRCm39) missense probably damaging 0.97
R4110:Phldb1 UTSW 9 44,627,128 (GRCm39) missense possibly damaging 0.88
R4772:Phldb1 UTSW 9 44,622,324 (GRCm39) missense probably damaging 1.00
R4857:Phldb1 UTSW 9 44,607,389 (GRCm39) missense probably damaging 0.99
R5148:Phldb1 UTSW 9 44,615,455 (GRCm39) missense probably benign 0.04
R5651:Phldb1 UTSW 9 44,623,200 (GRCm39) missense probably damaging 1.00
R5666:Phldb1 UTSW 9 44,627,078 (GRCm39) missense probably damaging 0.97
R5670:Phldb1 UTSW 9 44,627,078 (GRCm39) missense probably damaging 0.97
R5914:Phldb1 UTSW 9 44,622,948 (GRCm39) missense probably damaging 0.97
R6232:Phldb1 UTSW 9 44,607,414 (GRCm39) missense probably damaging 1.00
R6257:Phldb1 UTSW 9 44,607,437 (GRCm39) missense probably damaging 0.99
R6413:Phldb1 UTSW 9 44,607,440 (GRCm39) missense probably damaging 1.00
R6418:Phldb1 UTSW 9 44,623,197 (GRCm39) missense probably damaging 1.00
R6813:Phldb1 UTSW 9 44,610,865 (GRCm39) missense probably damaging 1.00
R6845:Phldb1 UTSW 9 44,627,359 (GRCm39) missense probably damaging 1.00
R7009:Phldb1 UTSW 9 44,605,705 (GRCm39) missense probably damaging 1.00
R7042:Phldb1 UTSW 9 44,605,721 (GRCm39) missense probably damaging 1.00
R7062:Phldb1 UTSW 9 44,607,432 (GRCm39) missense probably damaging 0.99
R7077:Phldb1 UTSW 9 44,623,201 (GRCm39) missense possibly damaging 0.62
R7307:Phldb1 UTSW 9 44,605,344 (GRCm39) missense possibly damaging 0.62
R7995:Phldb1 UTSW 9 44,626,669 (GRCm39) missense probably damaging 1.00
R8108:Phldb1 UTSW 9 44,622,458 (GRCm39) missense probably damaging 1.00
R8433:Phldb1 UTSW 9 44,627,759 (GRCm39) missense probably damaging 1.00
R9151:Phldb1 UTSW 9 44,619,740 (GRCm39) missense probably null 0.01
R9366:Phldb1 UTSW 9 44,622,546 (GRCm39) missense possibly damaging 0.93
R9378:Phldb1 UTSW 9 44,615,425 (GRCm39) missense probably benign 0.01
R9448:Phldb1 UTSW 9 44,622,546 (GRCm39) missense possibly damaging 0.93
R9539:Phldb1 UTSW 9 44,627,482 (GRCm39) missense probably damaging 1.00
R9641:Phldb1 UTSW 9 44,627,839 (GRCm39) missense probably damaging 1.00
RF020:Phldb1 UTSW 9 44,609,243 (GRCm39) missense probably damaging 1.00
X0020:Phldb1 UTSW 9 44,598,974 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATCTTTTCTTGAGGACAG -3'
(R):5'- TCCCAGAGCAGAAATGTTGAAG -3'

Sequencing Primer
(F):5'- TTCCACAGTGCAGCAGAG -3'
(R):5'- CCATAGATGGGTGACAGAGCCC -3'
Posted On 2015-05-28