Incidental Mutation 'R2339:Gm10134'
ID318106
Institutional Source Beutler Lab
Gene Symbol Gm10134
Ensembl Gene ENSMUSG00000063611
Gene Namepredicted gene 10134
Synonyms
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2339 (G1)
Quality Score23
Status Validated
Chromosome2
Chromosomal Location28506095-28506475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28506129 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 12 (S12F)
Ref Sequence ENSEMBL: ENSMUSP00000082978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028172] [ENSMUST00000074761] [ENSMUST00000163121]
Predicted Effect probably benign
Transcript: ENSMUST00000028172
SMART Domains Protein: ENSMUSP00000028172
Gene: ENSMUSG00000026829

DomainStartEndE-ValueType
transmembrane domain 7 24 N/A INTRINSIC
Pfam:Glyco_transf_6 33 347 1.6e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074761
AA Change: S12F

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000082978
Gene: ENSMUSG00000063611
AA Change: S12F

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127958
Predicted Effect probably benign
Transcript: ENSMUST00000163121
SMART Domains Protein: ENSMUSP00000127071
Gene: ENSMUSG00000026829

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 11 347 1.9e-152 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Gm10134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02431:Gm10134 APN 2 28506417 unclassified probably benign
R5288:Gm10134 UTSW 2 28506360 unclassified probably benign
R5385:Gm10134 UTSW 2 28506360 unclassified probably benign
R5994:Gm10134 UTSW 2 28506246 missense probably damaging 0.98
R6668:Gm10134 UTSW 2 28506251 nonsense probably null
R7594:Gm10134 UTSW 2 28506360 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGACCAGGCTTAGCTTCC -3'
(R):5'- GATTGTTTGAAATCCAGCTTGC -3'

Sequencing Primer
(F):5'- TCACCTGCATCCCATGGTGAG -3'
(R):5'- TTGAAATCCAGCTTGCAGCCG -3'
Posted On2015-05-29