Incidental Mutation 'R4171:Txndc17'
ID318141
Institutional Source Beutler Lab
Gene Symbol Txndc17
Ensembl Gene ENSMUSG00000020803
Gene Namethioredoxin domain containing 17
SynonymsD11Ertd672e, TRP14, 4831443O22Rik, Txnl5
MMRRC Submission 041011-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R4171 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72207547-72210015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72207711 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 30 (Y30H)
Ref Sequence ENSEMBL: ENSMUSP00000021158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021157] [ENSMUST00000021158] [ENSMUST00000108505] [ENSMUST00000108506] [ENSMUST00000131546] [ENSMUST00000142530] [ENSMUST00000204457]
PDB Structure
Solution structure of mouse putative 42-9-9 protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000021157
SMART Domains Protein: ENSMUSP00000021157
Gene: ENSMUSG00000020801

DomainStartEndE-ValueType
Pfam:Med31 15 109 2.7e-43 PFAM
low complexity region 115 125 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000021158
AA Change: Y30H

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021158
Gene: ENSMUSG00000020803
AA Change: Y30H

DomainStartEndE-ValueType
Pfam:DUF953 8 122 7.4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108505
SMART Domains Protein: ENSMUSP00000104145
Gene: ENSMUSG00000020807

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108506
SMART Domains Protein: ENSMUSP00000104146
Gene: ENSMUSG00000020807

DomainStartEndE-ValueType
Pfam:DUF4673 1 954 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128648
Predicted Effect probably benign
Transcript: ENSMUST00000131546
SMART Domains Protein: ENSMUSP00000122273
Gene: ENSMUSG00000020807

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
coiled coil region 625 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142530
SMART Domains Protein: ENSMUSP00000115276
Gene: ENSMUSG00000020807

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154093
Predicted Effect probably benign
Transcript: ENSMUST00000204457
SMART Domains Protein: ENSMUSP00000144817
Gene: ENSMUSG00000107877

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 26 43 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
Meta Mutation Damage Score 0.7861 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2310022A10Rik A G 7: 27,565,684 N87S probably benign Het
5330417C22Rik G T 3: 108,460,943 Q885K probably benign Het
Apmap A G 2: 150,584,067 V387A probably benign Het
B130024G19Rik C T 7: 70,388,706 noncoding transcript Het
Cd200r1 A G 16: 44,792,764 I244M probably damaging Het
Clic6 T C 16: 92,497,061 probably benign Het
Col11a1 A G 3: 114,208,214 D429G probably damaging Het
Dsg4 T A 18: 20,458,579 Y458* probably null Het
Fbxl13 A G 5: 21,543,788 Y378H probably benign Het
Ifi203 A C 1: 173,933,775 probably benign Het
Ifna6 T C 4: 88,827,801 V129A probably benign Het
Igkv3-4 G A 6: 70,672,340 A108T probably damaging Het
Itga1 G A 13: 115,030,886 Q165* probably null Het
Kdm4c T A 4: 74,280,898 Y108N possibly damaging Het
Lap3 T C 5: 45,509,491 S412P probably benign Het
Lrfn5 G A 12: 61,843,382 V486I probably damaging Het
Mep1b A T 18: 21,095,106 probably null Het
Mettl6 T C 14: 31,493,667 N52S probably damaging Het
Nup54 A G 5: 92,417,484 I458T possibly damaging Het
Olfr1 A C 11: 73,395,539 L161R probably damaging Het
Olfr773 G A 10: 129,186,584 A279V probably benign Het
Pecr A T 1: 72,276,269 N107K probably damaging Het
Pnpla6 A G 8: 3,543,997 Q1307R probably benign Het
Poll T C 19: 45,556,053 K310E probably damaging Het
Rab29 A G 1: 131,867,737 Q29R probably benign Het
Reg2 G A 6: 78,406,591 G99D probably damaging Het
Rftn2 G A 1: 55,214,270 S58L probably damaging Het
Rps6kb1 T C 11: 86,544,579 E43G possibly damaging Het
Sdk2 T C 11: 113,866,989 probably null Het
Slc38a6 T A 12: 73,350,552 Y323N probably benign Het
Sp100 T C 1: 85,706,841 S152P probably benign Het
Tmc5 A G 7: 118,649,587 Y605C probably damaging Het
Vmn1r44 T A 6: 89,894,014 F247L probably damaging Het
Zbtb39 C T 10: 127,742,367 T270I possibly damaging Het
Zfp512b G A 2: 181,590,598 probably null Het
Zwilch T A 9: 64,158,715 R255* probably null Het
Other mutations in Txndc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0212:Txndc17 UTSW 11 72207732 missense probably benign
R1536:Txndc17 UTSW 11 72207707 missense probably damaging 0.97
R1793:Txndc17 UTSW 11 72208745 missense probably benign 0.29
R4604:Txndc17 UTSW 11 72209448 missense probably benign
R5045:Txndc17 UTSW 11 72207711 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAACCTTGTCCACGCCTTAC -3'
(R):5'- GGTTCCAAGATCCGAATCCATG -3'

Sequencing Primer
(F):5'- GTCCACGCCTTACTTGGG -3'
(R):5'- TACAGCTCAGGCGCTTCTG -3'
Posted On2015-06-10