Incidental Mutation 'R4171:Olfr1'
ID318142
Institutional Source Beutler Lab
Gene Symbol Olfr1
Ensembl Gene ENSMUSG00000069823
Gene Nameolfactory receptor 1
SynonymsI54, MOR135-13, GA_x6K02T2P1NL-3556334-3555390
MMRRC Submission 041011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R4171 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73393010-73399614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73395539 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 161 (L161R)
Ref Sequence ENSEMBL: ENSMUSP00000120899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
Predicted Effect probably damaging
Transcript: ENSMUST00000120303
AA Change: L161R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823
AA Change: L161R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131253
AA Change: L161R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823
AA Change: L161R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2310022A10Rik A G 7: 27,565,684 N87S probably benign Het
5330417C22Rik G T 3: 108,460,943 Q885K probably benign Het
Apmap A G 2: 150,584,067 V387A probably benign Het
B130024G19Rik C T 7: 70,388,706 noncoding transcript Het
Cd200r1 A G 16: 44,792,764 I244M probably damaging Het
Clic6 T C 16: 92,497,061 probably benign Het
Col11a1 A G 3: 114,208,214 D429G probably damaging Het
Dsg4 T A 18: 20,458,579 Y458* probably null Het
Fbxl13 A G 5: 21,543,788 Y378H probably benign Het
Ifi203 A C 1: 173,933,775 probably benign Het
Ifna6 T C 4: 88,827,801 V129A probably benign Het
Igkv3-4 G A 6: 70,672,340 A108T probably damaging Het
Itga1 G A 13: 115,030,886 Q165* probably null Het
Kdm4c T A 4: 74,280,898 Y108N possibly damaging Het
Lap3 T C 5: 45,509,491 S412P probably benign Het
Lrfn5 G A 12: 61,843,382 V486I probably damaging Het
Mep1b A T 18: 21,095,106 probably null Het
Mettl6 T C 14: 31,493,667 N52S probably damaging Het
Nup54 A G 5: 92,417,484 I458T possibly damaging Het
Olfr773 G A 10: 129,186,584 A279V probably benign Het
Pecr A T 1: 72,276,269 N107K probably damaging Het
Pnpla6 A G 8: 3,543,997 Q1307R probably benign Het
Poll T C 19: 45,556,053 K310E probably damaging Het
Rab29 A G 1: 131,867,737 Q29R probably benign Het
Reg2 G A 6: 78,406,591 G99D probably damaging Het
Rftn2 G A 1: 55,214,270 S58L probably damaging Het
Rps6kb1 T C 11: 86,544,579 E43G possibly damaging Het
Sdk2 T C 11: 113,866,989 probably null Het
Slc38a6 T A 12: 73,350,552 Y323N probably benign Het
Sp100 T C 1: 85,706,841 S152P probably benign Het
Tmc5 A G 7: 118,649,587 Y605C probably damaging Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Vmn1r44 T A 6: 89,894,014 F247L probably damaging Het
Zbtb39 C T 10: 127,742,367 T270I possibly damaging Het
Zfp512b G A 2: 181,590,598 probably null Het
Zwilch T A 9: 64,158,715 R255* probably null Het
Other mutations in Olfr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Olfr1 APN 11 73395191 missense probably damaging 0.98
IGL01938:Olfr1 APN 11 73395645 missense probably damaging 1.00
IGL02270:Olfr1 APN 11 73395365 missense probably benign
IGL03287:Olfr1 APN 11 73396019 start codon destroyed probably null 1.00
R0006:Olfr1 UTSW 11 73395488 missense probably damaging 0.99
R0907:Olfr1 UTSW 11 73395119 missense probably damaging 0.97
R1982:Olfr1 UTSW 11 73395092 missense probably benign 0.00
R3804:Olfr1 UTSW 11 73395950 missense probably benign 0.01
R4064:Olfr1 UTSW 11 73395522 missense probably benign 0.04
R4724:Olfr1 UTSW 11 73395155 missense probably damaging 1.00
R4732:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R4733:Olfr1 UTSW 11 73395695 missense probably benign 0.03
R5030:Olfr1 UTSW 11 73395654 frame shift probably null
R5097:Olfr1 UTSW 11 73395293 missense probably damaging 1.00
R5098:Olfr1 UTSW 11 73395654 frame shift probably null
R5101:Olfr1 UTSW 11 73395654 frame shift probably null
R5135:Olfr1 UTSW 11 73395654 frame shift probably null
R5137:Olfr1 UTSW 11 73395654 frame shift probably null
R5192:Olfr1 UTSW 11 73395654 frame shift probably null
R5193:Olfr1 UTSW 11 73395653 frame shift probably null
R5193:Olfr1 UTSW 11 73395654 frame shift probably null
R5197:Olfr1 UTSW 11 73395654 frame shift probably null
R5220:Olfr1 UTSW 11 73395654 frame shift probably null
R5221:Olfr1 UTSW 11 73395654 frame shift probably null
R5222:Olfr1 UTSW 11 73395654 frame shift probably null
R5258:Olfr1 UTSW 11 73395654 frame shift probably null
R5297:Olfr1 UTSW 11 73395654 frame shift probably null
R5396:Olfr1 UTSW 11 73395654 frame shift probably null
R5398:Olfr1 UTSW 11 73395654 frame shift probably null
R5399:Olfr1 UTSW 11 73395654 frame shift probably null
R5432:Olfr1 UTSW 11 73395654 frame shift probably null
R5433:Olfr1 UTSW 11 73395654 frame shift probably null
R5531:Olfr1 UTSW 11 73395177 missense probably benign 0.26
R5634:Olfr1 UTSW 11 73395654 frame shift probably null
R5714:Olfr1 UTSW 11 73395361 unclassified probably null
R5812:Olfr1 UTSW 11 73395654 frame shift probably null
R5813:Olfr1 UTSW 11 73395654 frame shift probably null
R5814:Olfr1 UTSW 11 73395654 frame shift probably null
R5815:Olfr1 UTSW 11 73395654 frame shift probably null
R5913:Olfr1 UTSW 11 73395654 frame shift probably null
R5955:Olfr1 UTSW 11 73395654 frame shift probably null
R5956:Olfr1 UTSW 11 73395654 frame shift probably null
R5968:Olfr1 UTSW 11 73395192 missense possibly damaging 0.75
R6029:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6034:Olfr1 UTSW 11 73395654 frame shift probably null
R6176:Olfr1 UTSW 11 73395654 frame shift probably null
R6177:Olfr1 UTSW 11 73395654 frame shift probably null
R6178:Olfr1 UTSW 11 73395654 frame shift probably null
R6196:Olfr1 UTSW 11 73395473 missense probably benign 0.08
R6995:Olfr1 UTSW 11 73395584 missense probably benign
R7035:Olfr1 UTSW 11 73395718 missense probably benign 0.00
R7470:Olfr1 UTSW 11 73395888 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTGAGAAGAAGGGACCTTG -3'
(R):5'- GGTTGCCTGGCACAAATATAC -3'

Sequencing Primer
(F):5'- CCTTGAGAATGGAAGACACAATTC -3'
(R):5'- GCCTGGCACAAATATACTTCTTTCTG -3'
Posted On2015-06-10