Incidental Mutation 'R4171:Itga1'
ID318148
Institutional Source Beutler Lab
Gene Symbol Itga1
Ensembl Gene ENSMUSG00000042284
Gene Nameintegrin alpha 1
SynonymsCD49A, Vla1, E130012M19Rik
MMRRC Submission 041011-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.446) question?
Stock #R4171 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location114953096-115101964 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 115030886 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 165 (Q165*)
Ref Sequence ENSEMBL: ENSMUSP00000077132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061673] [ENSMUST00000224495]
Predicted Effect probably null
Transcript: ENSMUST00000061673
AA Change: Q165*
SMART Domains Protein: ENSMUSP00000077132
Gene: ENSMUSG00000042284
AA Change: Q165*

DomainStartEndE-ValueType
Int_alpha 43 96 1.63e0 SMART
VWA 170 360 4.24e-44 SMART
Int_alpha 432 481 4.21e-3 SMART
Int_alpha 485 542 3.19e-12 SMART
Int_alpha 566 621 1.79e-15 SMART
Int_alpha 628 682 3.04e1 SMART
low complexity region 1108 1122 N/A INTRINSIC
PDB:2L8S|A 1135 1179 5e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224493
Predicted Effect probably benign
Transcript: ENSMUST00000224495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224865
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha 1 subunit of integrin receptors. This protein heterodimerizes with the beta 1 subunit to form a cell-surface receptor for collagen and laminin. The heterodimeric receptor is involved in cell-cell adhesion and may play a role in inflammation and fibrosis. The alpha 1 subunit contains an inserted (I) von Willebrand factor type I domain which is thought to be involved in collagen binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially normal although their kidneys are smaller and more succeptible to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2310022A10Rik A G 7: 27,565,684 N87S probably benign Het
5330417C22Rik G T 3: 108,460,943 Q885K probably benign Het
Apmap A G 2: 150,584,067 V387A probably benign Het
B130024G19Rik C T 7: 70,388,706 noncoding transcript Het
Cd200r1 A G 16: 44,792,764 I244M probably damaging Het
Clic6 T C 16: 92,497,061 probably benign Het
Col11a1 A G 3: 114,208,214 D429G probably damaging Het
Dsg4 T A 18: 20,458,579 Y458* probably null Het
Fbxl13 A G 5: 21,543,788 Y378H probably benign Het
Ifi203 A C 1: 173,933,775 probably benign Het
Ifna6 T C 4: 88,827,801 V129A probably benign Het
Igkv3-4 G A 6: 70,672,340 A108T probably damaging Het
Kdm4c T A 4: 74,280,898 Y108N possibly damaging Het
Lap3 T C 5: 45,509,491 S412P probably benign Het
Lrfn5 G A 12: 61,843,382 V486I probably damaging Het
Mep1b A T 18: 21,095,106 probably null Het
Mettl6 T C 14: 31,493,667 N52S probably damaging Het
Nup54 A G 5: 92,417,484 I458T possibly damaging Het
Olfr1 A C 11: 73,395,539 L161R probably damaging Het
Olfr773 G A 10: 129,186,584 A279V probably benign Het
Pecr A T 1: 72,276,269 N107K probably damaging Het
Pnpla6 A G 8: 3,543,997 Q1307R probably benign Het
Poll T C 19: 45,556,053 K310E probably damaging Het
Rab29 A G 1: 131,867,737 Q29R probably benign Het
Reg2 G A 6: 78,406,591 G99D probably damaging Het
Rftn2 G A 1: 55,214,270 S58L probably damaging Het
Rps6kb1 T C 11: 86,544,579 E43G possibly damaging Het
Sdk2 T C 11: 113,866,989 probably null Het
Slc38a6 T A 12: 73,350,552 Y323N probably benign Het
Sp100 T C 1: 85,706,841 S152P probably benign Het
Tmc5 A G 7: 118,649,587 Y605C probably damaging Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Vmn1r44 T A 6: 89,894,014 F247L probably damaging Het
Zbtb39 C T 10: 127,742,367 T270I possibly damaging Het
Zfp512b G A 2: 181,590,598 probably null Het
Zwilch T A 9: 64,158,715 R255* probably null Het
Other mutations in Itga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Itga1 APN 13 114992363 missense possibly damaging 0.80
IGL00498:Itga1 APN 13 115031193 missense probably benign 0.00
IGL00549:Itga1 APN 13 115049296 missense possibly damaging 0.92
IGL00587:Itga1 APN 13 115012249 missense probably damaging 1.00
IGL01021:Itga1 APN 13 114997000 missense probably benign 0.29
IGL01289:Itga1 APN 13 114986226 missense possibly damaging 0.79
IGL01636:Itga1 APN 13 115006948 missense possibly damaging 0.73
IGL01791:Itga1 APN 13 114987661 missense probably benign 0.00
IGL01796:Itga1 APN 13 114985121 missense probably damaging 1.00
IGL02027:Itga1 APN 13 114990055 splice site probably null
IGL02330:Itga1 APN 13 115012204 missense probably damaging 1.00
IGL02480:Itga1 APN 13 114987648 missense probably damaging 1.00
IGL02943:Itga1 APN 13 115049296 missense possibly damaging 0.92
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0103:Itga1 UTSW 13 115016254 missense probably benign 0.40
R0244:Itga1 UTSW 13 115006897 splice site probably benign
R0265:Itga1 UTSW 13 114992459 missense probably benign
R0302:Itga1 UTSW 13 115012318 splice site probably benign
R0320:Itga1 UTSW 13 114977594 splice site probably benign
R0389:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0443:Itga1 UTSW 13 114992460 missense probably benign 0.04
R0574:Itga1 UTSW 13 114966561 missense probably damaging 1.00
R0646:Itga1 UTSW 13 114968299 missense probably benign
R0830:Itga1 UTSW 13 115007032 missense probably benign 0.08
R2162:Itga1 UTSW 13 115030910 missense probably benign 0.23
R2216:Itga1 UTSW 13 114997029 missense probably benign 0.00
R2403:Itga1 UTSW 13 114977614 missense probably benign 0.00
R3734:Itga1 UTSW 13 114977639 missense probably benign
R4402:Itga1 UTSW 13 115001566 missense probably benign 0.00
R4675:Itga1 UTSW 13 115001691 splice site probably null
R4684:Itga1 UTSW 13 115049370 missense probably damaging 1.00
R4795:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4796:Itga1 UTSW 13 115035385 missense probably damaging 1.00
R4845:Itga1 UTSW 13 114974172 nonsense probably null
R5147:Itga1 UTSW 13 114985142 missense possibly damaging 0.91
R5155:Itga1 UTSW 13 115035303 missense probably benign
R5234:Itga1 UTSW 13 115049303 nonsense probably null
R5344:Itga1 UTSW 13 115002309 missense possibly damaging 0.78
R5554:Itga1 UTSW 13 114992474 nonsense probably null
R5662:Itga1 UTSW 13 114986171 missense probably benign 0.03
R5945:Itga1 UTSW 13 114966590 missense probably benign 0.02
R6150:Itga1 UTSW 13 114968233 missense probably benign 0.01
R6241:Itga1 UTSW 13 114960137 splice site probably null
R6276:Itga1 UTSW 13 114980852 missense probably benign
R6369:Itga1 UTSW 13 114965660 missense probably damaging 1.00
R6511:Itga1 UTSW 13 114992501 missense probably damaging 0.98
R6663:Itga1 UTSW 13 114974105 missense probably benign 0.02
R6783:Itga1 UTSW 13 114996977 missense probably benign 0.22
R6931:Itga1 UTSW 13 115001563 missense probably benign 0.39
R7069:Itga1 UTSW 13 114968240 missense probably damaging 1.00
R7458:Itga1 UTSW 13 114986266 missense probably benign 0.00
R7588:Itga1 UTSW 13 114968249 missense possibly damaging 0.88
R7591:Itga1 UTSW 13 114982779 missense probably damaging 1.00
R7597:Itga1 UTSW 13 114974140 missense probably benign 0.28
R7615:Itga1 UTSW 13 114996922 missense probably null 0.99
R7756:Itga1 UTSW 13 114992460 missense probably benign 0.04
R7795:Itga1 UTSW 13 115012236 missense probably damaging 1.00
R7819:Itga1 UTSW 13 115049301 missense probably damaging 0.99
Z1177:Itga1 UTSW 13 114985071 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACCAGCATGATAGTATTAGCTGTG -3'
(R):5'- GAGTCATTTATGTCTTGAACCCTGTTG -3'

Sequencing Primer
(F):5'- AAATCCGGGAAGCCTTTG -3'
(R):5'- GTCTTGAACCCTGTTGTATAATGTTC -3'
Posted On2015-06-10