Incidental Mutation 'R0393:Spock1'
ID31815
Institutional Source Beutler Lab
Gene Symbol Spock1
Ensembl Gene ENSMUSG00000056222
Gene Namesparc/osteonectin, cwcv and kazal-like domains proteoglycan 1
Synonymstestican 1, Ticn1
MMRRC Submission 038599-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0393 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location57421195-57908332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57440536 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 241 (D241G)
Ref Sequence ENSEMBL: ENSMUSP00000139863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172326] [ENSMUST00000185502] [ENSMUST00000185905] [ENSMUST00000186271] [ENSMUST00000187852] [ENSMUST00000189373]
Predicted Effect probably damaging
Transcript: ENSMUST00000172326
AA Change: D238G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128840
Gene: ENSMUSG00000056222
AA Change: D238G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 135 180 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 195 304 6e-35 PFAM
TY 334 380 9.64e-21 SMART
low complexity region 394 404 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185502
AA Change: D241G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140409
Gene: ENSMUSG00000056222
AA Change: D241G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 138 183 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 198 307 3.1e-33 PFAM
TY 337 383 9.64e-21 SMART
low complexity region 397 407 N/A INTRINSIC
low complexity region 425 437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185905
AA Change: D238G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000186271
AA Change: D238G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140755
Gene: ENSMUSG00000056222
AA Change: D238G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 135 180 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 195 304 3.1e-33 PFAM
TY 334 380 9.64e-21 SMART
low complexity region 394 404 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187852
AA Change: D238G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141130
Gene: ENSMUSG00000056222
AA Change: D238G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 135 180 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 195 304 2.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189373
AA Change: D241G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139863
Gene: ENSMUSG00000056222
AA Change: D241G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 24 42 N/A INTRINSIC
KAZAL 138 183 3.67e-12 SMART
Pfam:SPARC_Ca_bdg 198 307 1.3e-33 PFAM
Meta Mutation Damage Score 0.6397 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein core of a seminal plasma proteoglycan containing chondroitin- and heparan-sulfate chains. The protein's function is unknown, although similarity to thyropin-type cysteine protease-inhibitors suggests its function may be related to protease inhibition. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation display no obvious morphological or behavioral abnormalities, are fertile, and have normal life spans. Adult homozygotes exhibit normal brain morphology and EEG recordings. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C T 6: 142,645,878 probably benign Het
Akr1b7 T G 6: 34,415,400 Y49* probably null Het
Ankrd10 G T 8: 11,635,482 R46S possibly damaging Het
Atp13a5 A G 16: 29,266,929 probably benign Het
Baz1a A G 12: 54,918,436 probably null Het
Bicd2 C T 13: 49,379,870 T644M probably damaging Het
Ccr9 A T 9: 123,779,970 H239L probably benign Het
Cd180 A T 13: 102,705,900 N485Y probably damaging Het
Ces1d T A 8: 93,192,772 S131C probably damaging Het
Cnpy2 T A 10: 128,326,207 S116R probably benign Het
Crym T C 7: 120,189,749 K285R probably benign Het
Cyp2a4 A T 7: 26,312,868 I359F possibly damaging Het
Cyp2b10 T A 7: 25,914,934 probably benign Het
Dcpp3 A T 17: 23,917,951 probably benign Het
Dnah8 T A 17: 30,708,390 I1340K probably benign Het
Fbln1 T C 15: 85,227,076 C144R probably damaging Het
Gm1553 T C 10: 82,492,176 R66G unknown Het
Il10rb G A 16: 91,412,010 V103I probably benign Het
Irak1bp1 T A 9: 82,846,561 W182R probably benign Het
Kcna3 T C 3: 107,036,999 S193P probably damaging Het
Kif14 C T 1: 136,482,418 H628Y probably damaging Het
Krt31 A G 11: 100,050,253 L77P probably damaging Het
Krt36 C T 11: 100,104,114 A211T possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lmo7 A G 14: 101,900,456 T743A probably benign Het
Lyst C T 13: 13,647,079 T1346M probably benign Het
Mapkbp1 T A 2: 120,012,903 probably null Het
Mif T C 10: 75,859,804 D55G probably benign Het
Mlh3 G T 12: 85,267,587 C608* probably null Het
Mlip A T 9: 77,239,577 C85S probably benign Het
Mug1 T C 6: 121,849,850 S211P possibly damaging Het
Mybl2 T A 2: 163,061,608 probably benign Het
Myh8 C T 11: 67,306,017 probably benign Het
Nanos1 A G 19: 60,756,930 Y222C probably damaging Het
Olfr1113 A T 2: 87,213,693 Y267F probably benign Het
Olfr1155 T C 2: 87,943,565 D21G possibly damaging Het
Olfr138 G T 17: 38,274,883 M37I probably benign Het
Papolb A G 5: 142,529,456 V144A probably damaging Het
Pctp A G 11: 89,986,119 S185P probably benign Het
Plod1 A T 4: 147,918,841 L509Q probably null Het
Ppp1r13b C A 12: 111,835,688 M290I probably benign Het
Ralb G C 1: 119,478,126 probably null Het
Slc4a8 T A 15: 100,774,638 D18E probably damaging Het
Speg A C 1: 75,423,924 H2576P possibly damaging Het
Tcam1 T A 11: 106,284,214 V165E probably benign Het
Thbs1 T A 2: 118,112,991 V30E possibly damaging Het
Tll2 A G 19: 41,088,826 Y834H possibly damaging Het
Tmem5 T C 10: 122,095,936 probably benign Het
Trpm6 G A 19: 18,778,644 D84N probably damaging Het
Ubr1 T A 2: 120,906,946 Q1039L probably damaging Het
Ubr4 A G 4: 139,410,860 probably benign Het
Vmn1r74 T C 7: 11,847,315 Y181H possibly damaging Het
Vmn2r13 T C 5: 109,156,529 T679A probably benign Het
Vmn2r91 A T 17: 18,105,450 Y110F probably damaging Het
Zbtb40 A C 4: 137,018,531 S64A probably benign Het
Zfp184 T A 13: 21,947,082 probably benign Het
Other mutations in Spock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Spock1 APN 13 57587739 splice site probably benign
IGL00491:Spock1 APN 13 57556806 missense possibly damaging 0.67
IGL01942:Spock1 APN 13 57430328 missense probably damaging 1.00
IGL01998:Spock1 APN 13 57436181 splice site probably benign
IGL02428:Spock1 APN 13 57444432 splice site probably benign
IGL02805:Spock1 APN 13 57907577 missense possibly damaging 0.46
IGL02814:Spock1 APN 13 57587673 missense probably damaging 1.00
IGL03307:Spock1 APN 13 57429347 missense probably null 1.00
R0227:Spock1 UTSW 13 57440477 missense possibly damaging 0.86
R0243:Spock1 UTSW 13 57436109 critical splice donor site probably null
R1298:Spock1 UTSW 13 57512750 missense probably benign 0.00
R1393:Spock1 UTSW 13 57907454 missense probably damaging 1.00
R1467:Spock1 UTSW 13 57429369 missense possibly damaging 0.53
R1467:Spock1 UTSW 13 57429369 missense possibly damaging 0.53
R2134:Spock1 UTSW 13 57436139 missense probably damaging 0.99
R4386:Spock1 UTSW 13 57440450 missense probably damaging 1.00
R5524:Spock1 UTSW 13 57556795 missense probably damaging 1.00
R5765:Spock1 UTSW 13 57429404 missense probably benign 0.19
R7195:Spock1 UTSW 13 57907502 missense possibly damaging 0.92
R7446:Spock1 UTSW 13 57436085 missense unknown
R7701:Spock1 UTSW 13 57587659 nonsense probably null
R8256:Spock1 UTSW 13 57440444 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACGAGTTGAAGAGAGGCTTGATGC -3'
(R):5'- GTTGGCTCTTGCCTTTAGGACATTTGTA -3'

Sequencing Primer
(F):5'- GATGCAGGGCTCATATTTGTC -3'
(R):5'- ggaagaggagggggagaag -3'
Posted On2013-04-24