Incidental Mutation 'R4171:Dsg4'
ID318151
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
MMRRC Submission 041011-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R4171 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 20458579 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 458 (Y458*)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect probably null
Transcript: ENSMUST00000019426
AA Change: Y458*
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: Y458*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2310022A10Rik A G 7: 27,565,684 N87S probably benign Het
5330417C22Rik G T 3: 108,460,943 Q885K probably benign Het
Apmap A G 2: 150,584,067 V387A probably benign Het
B130024G19Rik C T 7: 70,388,706 noncoding transcript Het
Cd200r1 A G 16: 44,792,764 I244M probably damaging Het
Clic6 T C 16: 92,497,061 probably benign Het
Col11a1 A G 3: 114,208,214 D429G probably damaging Het
Fbxl13 A G 5: 21,543,788 Y378H probably benign Het
Ifi203 A C 1: 173,933,775 probably benign Het
Ifna6 T C 4: 88,827,801 V129A probably benign Het
Igkv3-4 G A 6: 70,672,340 A108T probably damaging Het
Itga1 G A 13: 115,030,886 Q165* probably null Het
Kdm4c T A 4: 74,280,898 Y108N possibly damaging Het
Lap3 T C 5: 45,509,491 S412P probably benign Het
Lrfn5 G A 12: 61,843,382 V486I probably damaging Het
Mep1b A T 18: 21,095,106 probably null Het
Mettl6 T C 14: 31,493,667 N52S probably damaging Het
Nup54 A G 5: 92,417,484 I458T possibly damaging Het
Olfr1 A C 11: 73,395,539 L161R probably damaging Het
Olfr773 G A 10: 129,186,584 A279V probably benign Het
Pecr A T 1: 72,276,269 N107K probably damaging Het
Pnpla6 A G 8: 3,543,997 Q1307R probably benign Het
Poll T C 19: 45,556,053 K310E probably damaging Het
Rab29 A G 1: 131,867,737 Q29R probably benign Het
Reg2 G A 6: 78,406,591 G99D probably damaging Het
Rftn2 G A 1: 55,214,270 S58L probably damaging Het
Rps6kb1 T C 11: 86,544,579 E43G possibly damaging Het
Sdk2 T C 11: 113,866,989 probably null Het
Slc38a6 T A 12: 73,350,552 Y323N probably benign Het
Sp100 T C 1: 85,706,841 S152P probably benign Het
Tmc5 A G 7: 118,649,587 Y605C probably damaging Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Vmn1r44 T A 6: 89,894,014 F247L probably damaging Het
Zbtb39 C T 10: 127,742,367 T270I possibly damaging Het
Zfp512b G A 2: 181,590,598 probably null Het
Zwilch T A 9: 64,158,715 R255* probably null Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 intron probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
R7988:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATTGTTGCCAACCTAACAC -3'
(R):5'- GTGAGATACATTTTGGCTTGAGTAC -3'

Sequencing Primer
(F):5'- ACATTTAATCCTGGATACTCACCGG -3'
(R):5'- CATTTTGGCTTGAGTACAATTTATGG -3'
Posted On2015-06-10