Incidental Mutation 'R4172:Npbwr1'
List |< first << previous [record 17 of 37] next >> last >|
ID318154
Institutional Source Beutler Lab
Gene Symbol Npbwr1
Ensembl Gene ENSMUSG00000033774
Gene Nameneuropeptides B/W receptor 1
SynonymsGpr7
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location5913707-5917398 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5916936 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 120 (Y120H)
Ref Sequence ENSEMBL: ENSMUSP00000046233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044180]
Predicted Effect probably damaging
Transcript: ENSMUST00000044180
AA Change: Y120H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046233
Gene: ENSMUSG00000033774
AA Change: Y120H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srw 44 327 1.3e-7 PFAM
Pfam:7TM_GPCR_Srsx 50 324 8.5e-10 PFAM
Pfam:7tm_1 56 309 1e-48 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null males develop adult-onset obesity, are hyperphagic, and have decreased energy expenditure and locomotor activity. Plasma levels of glucose, leptin and insulin are elevated in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Npbwr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Npbwr1 APN 1 5916965 missense possibly damaging 0.55
R0140:Npbwr1 UTSW 1 5916621 missense probably damaging 1.00
R0585:Npbwr1 UTSW 1 5916458 missense possibly damaging 0.72
R0827:Npbwr1 UTSW 1 5916789 missense possibly damaging 0.85
R1472:Npbwr1 UTSW 1 5916681 missense probably damaging 1.00
R1646:Npbwr1 UTSW 1 5917254 missense probably benign 0.01
R2001:Npbwr1 UTSW 1 5917175 missense possibly damaging 0.81
R2004:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2005:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2006:Npbwr1 UTSW 1 5916351 missense probably damaging 1.00
R2259:Npbwr1 UTSW 1 5916658 missense probably damaging 1.00
R5614:Npbwr1 UTSW 1 5916811 missense probably damaging 1.00
R6379:Npbwr1 UTSW 1 5917219 missense probably benign 0.03
R7022:Npbwr1 UTSW 1 5917100 missense probably damaging 1.00
R7462:Npbwr1 UTSW 1 5916932 missense probably damaging 1.00
R7678:Npbwr1 UTSW 1 5916708 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCAATACTAGTGTGTAGAGACGGC -3'
(R):5'- TAATTTGCGCCGTGGGACTG -3'

Sequencing Primer
(F):5'- TCGTCCAGCCGAGCGAATAC -3'
(R):5'- AACTCTGCGGTGCTGTACGTAC -3'
Posted On2015-06-10