Incidental Mutation 'R4172:Olfr48'
ID318158
Institutional Source Beutler Lab
Gene Symbol Olfr48
Ensembl Gene ENSMUSG00000075072
Gene Nameolfactory receptor 48
SynonymsIC3, MOR232-5, GA_x6K02T2Q125-51285881-51284976
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location89841793-89848205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 89844778 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 65 (D65A)
Ref Sequence ENSEMBL: ENSMUSP00000150505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099762] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000214428] [ENSMUST00000215613]
Predicted Effect probably damaging
Transcript: ENSMUST00000099762
AA Change: D65A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097350
Gene: ENSMUSG00000075072
AA Change: D65A

DomainStartEndE-ValueType
Pfam:7tm_4 26 299 1e-47 PFAM
Pfam:7tm_1 36 282 8.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111520
SMART Domains Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213833
Predicted Effect probably damaging
Transcript: ENSMUST00000214428
AA Change: D65A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000215613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216674
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Olfr48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Olfr48 APN 2 89844095 missense probably benign 0.00
IGL02184:Olfr48 APN 2 89844385 missense probably damaging 0.98
IGL02408:Olfr48 APN 2 89844971 start codon destroyed probably benign 0.04
IGL02437:Olfr48 APN 2 89844784 missense probably damaging 0.98
IGL02985:Olfr48 APN 2 89844340 missense possibly damaging 0.66
IGL03230:Olfr48 APN 2 89844113 missense probably benign
IGL03393:Olfr48 APN 2 89844569 missense probably benign 0.00
R0482:Olfr48 UTSW 2 89844169 missense probably benign 0.20
R0555:Olfr48 UTSW 2 89844443 missense probably benign 0.00
R1268:Olfr48 UTSW 2 89844154 missense probably damaging 0.98
R1617:Olfr48 UTSW 2 89844254 missense probably benign 0.03
R3552:Olfr48 UTSW 2 89844343 missense possibly damaging 0.53
R4173:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R4174:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R5540:Olfr48 UTSW 2 89844667 missense probably damaging 1.00
R5909:Olfr48 UTSW 2 89844391 missense possibly damaging 0.89
R5941:Olfr48 UTSW 2 89844515 missense probably benign 0.07
R7425:Olfr48 UTSW 2 89844445 missense probably damaging 0.99
R7445:Olfr48 UTSW 2 89844272 missense probably damaging 0.99
R7660:Olfr48 UTSW 2 89844443 missense probably benign 0.00
R7996:Olfr48 UTSW 2 89844415 missense not run
R8026:Olfr48 UTSW 2 89844929 missense not run
Predicted Primers PCR Primer
(F):5'- TACAGATGGCCACATAGCGG -3'
(R):5'- GACATTCCTCTGTCAGGTGAG -3'

Sequencing Primer
(F):5'- GTCGTAGGCCATCACTGTGAG -3'
(R):5'- CCTCTGTCAGGTGAGATAAATCG -3'
Posted On2015-06-10