Incidental Mutation 'R4172:Snx27'
List |< first << previous [record 25 of 37] next >> last >|
ID318164
Institutional Source Beutler Lab
Gene Symbol Snx27
Ensembl Gene ENSMUSG00000028136
Gene Namesorting nexin family member 27
SynonymsESTM47, 5730552M22Rik
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location94497544-94582716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94503487 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 452 (H452R)
Ref Sequence ENSEMBL: ENSMUSP00000102904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029783] [ENSMUST00000107283] [ENSMUST00000199462] [ENSMUST00000200642]
Predicted Effect probably benign
Transcript: ENSMUST00000029783
AA Change: H452R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029783
Gene: ENSMUSG00000028136
AA Change: H452R

DomainStartEndE-ValueType
low complexity region 18 38 N/A INTRINSIC
PDZ 49 134 3.77e-19 SMART
PX 154 263 7.5e-21 SMART
Pfam:RA 271 360 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107283
AA Change: H452R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102904
Gene: ENSMUSG00000028136
AA Change: H452R

DomainStartEndE-ValueType
low complexity region 18 38 N/A INTRINSIC
PDZ 49 134 3.77e-19 SMART
PX 154 263 7.5e-21 SMART
Pfam:RA 271 360 1.5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196675
Predicted Effect probably benign
Transcript: ENSMUST00000199462
SMART Domains Protein: ENSMUSP00000143378
Gene: ENSMUSG00000028136

DomainStartEndE-ValueType
low complexity region 18 38 N/A INTRINSIC
PDB:3QE1|A 39 58 9e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000200642
AA Change: H361R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143066
Gene: ENSMUSG00000028136
AA Change: H361R

DomainStartEndE-ValueType
PDB:3QGL|E 12 42 3e-12 PDB
PX 63 172 7.5e-21 SMART
Pfam:RA 180 269 5.3e-14 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family, a diverse group of cytoplasmic and membrane-associated proteins involved in endocytosis of plasma membrane receptors and protein trafficking through these compartments. All members of this protein family contain a phosphoinositide binding domain (PX domain). A highly similar protein in mouse is responsible for the specific recruitment of an isoform of serotonin 5-hydroxytryptamine 4 receptor into early endosomes, suggesting the analogous role for the human protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal and postnatal lethality, decreased organ size, slow postnatal weight gain, and decreased endocytosis of Grin2c. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Snx27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Snx27 APN 3 94561972 missense probably damaging 1.00
IGL01061:Snx27 APN 3 94528980 splice site probably benign
IGL01598:Snx27 APN 3 94561843 missense probably damaging 1.00
IGL02276:Snx27 APN 3 94531379 missense probably damaging 1.00
IGL02558:Snx27 APN 3 94502881 missense probably damaging 0.99
IGL02748:Snx27 APN 3 94503565 missense probably benign 0.04
IGL02817:Snx27 APN 3 94503463 missense probably damaging 1.00
IGL02965:Snx27 APN 3 94582426 missense probably damaging 0.99
R0733:Snx27 UTSW 3 94562013 missense probably benign 0.03
R1241:Snx27 UTSW 3 94520233 missense probably benign 0.18
R1882:Snx27 UTSW 3 94519109 missense probably damaging 0.97
R2517:Snx27 UTSW 3 94531234 missense probably damaging 1.00
R3850:Snx27 UTSW 3 94520235 missense probably benign 0.00
R3964:Snx27 UTSW 3 94531306 missense probably damaging 1.00
R4035:Snx27 UTSW 3 94524244 missense probably damaging 0.99
R4424:Snx27 UTSW 3 94562023 missense probably benign 0.03
R4425:Snx27 UTSW 3 94562023 missense probably benign 0.03
R4548:Snx27 UTSW 3 94526439 intron probably benign
R4820:Snx27 UTSW 3 94520211 missense probably damaging 1.00
R5114:Snx27 UTSW 3 94524244 missense probably damaging 1.00
R5672:Snx27 UTSW 3 94502850 splice site probably null
R5877:Snx27 UTSW 3 94502963 missense probably damaging 1.00
R7138:Snx27 UTSW 3 94528940 missense probably benign 0.04
R7284:Snx27 UTSW 3 94524191 missense probably damaging 0.97
R7403:Snx27 UTSW 3 94528926 missense probably damaging 1.00
R7593:Snx27 UTSW 3 94502965 missense possibly damaging 0.83
R7827:Snx27 UTSW 3 94519059 missense probably benign 0.11
X0057:Snx27 UTSW 3 94524274 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- CTAGTACAATAAGGATCAATGTGGGC -3'
(R):5'- GAGATGAGAAGCCAGGTCTC -3'

Sequencing Primer
(F):5'- TAAGGATCAATGTGGGCTCACTG -3'
(R):5'- CGTCTCAGTAACTGCACTGG -3'
Posted On2015-06-10