Incidental Mutation 'R4172:Ube2j2'
ID318167
Institutional Source Beutler Lab
Gene Symbol Ube2j2
Ensembl Gene ENSMUSG00000023286
Gene Nameubiquitin-conjugating enzyme E2J 2
Synonyms1200007B18Rik, Ubc6, 5730472G04Rik, 2400008G19Rik
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location155943831-155959604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155949086 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 39 (D39G)
Ref Sequence ENSEMBL: ENSMUSP00000101208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024056] [ENSMUST00000103175] [ENSMUST00000105581] [ENSMUST00000105582] [ENSMUST00000105583] [ENSMUST00000118192] [ENSMUST00000136492] [ENSMUST00000152536] [ENSMUST00000166489]
Predicted Effect probably damaging
Transcript: ENSMUST00000024056
AA Change: D39G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024056
Gene: ENSMUSG00000023286
AA Change: D39G

DomainStartEndE-ValueType
UBCc 27 181 3.22e-31 SMART
low complexity region 218 234 N/A INTRINSIC
Blast:UBCc 235 270 7e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000103175
AA Change: D27G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099464
Gene: ENSMUSG00000023286
AA Change: D27G

DomainStartEndE-ValueType
UBCc 15 169 3.22e-31 SMART
low complexity region 206 222 N/A INTRINSIC
Blast:UBCc 223 258 7e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105581
AA Change: D27G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101206
Gene: ENSMUSG00000023286
AA Change: D27G

DomainStartEndE-ValueType
UBCc 15 169 3.22e-31 SMART
low complexity region 206 222 N/A INTRINSIC
Blast:UBCc 223 258 7e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105582
AA Change: D39G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101207
Gene: ENSMUSG00000023286
AA Change: D39G

DomainStartEndE-ValueType
UBCc 27 181 3.22e-31 SMART
low complexity region 218 234 N/A INTRINSIC
Blast:UBCc 235 270 7e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000105583
AA Change: D39G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101208
Gene: ENSMUSG00000023286
AA Change: D39G

DomainStartEndE-ValueType
UBCc 27 181 3.22e-31 SMART
low complexity region 218 234 N/A INTRINSIC
Blast:UBCc 235 270 7e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000118192
AA Change: D27G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112785
Gene: ENSMUSG00000023286
AA Change: D27G

DomainStartEndE-ValueType
UBCc 15 153 5.28e-27 SMART
low complexity region 179 195 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136492
AA Change: D27G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150846
Predicted Effect probably benign
Transcript: ENSMUST00000152536
SMART Domains Protein: ENSMUSP00000114235
Gene: ENSMUSG00000023286

DomainStartEndE-ValueType
UBCc 2 117 5.4e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166489
AA Change: D27G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127712
Gene: ENSMUSG00000023286
AA Change: D27G

DomainStartEndE-ValueType
UBCc 15 169 3.22e-31 SMART
low complexity region 206 222 N/A INTRINSIC
Blast:UBCc 223 258 7e-6 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is located in the membrane of the endoplasmic reticulum. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Ube2j2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Ube2j2 APN 4 155956447 missense possibly damaging 0.79
IGL00951:Ube2j2 APN 4 155946377 intron probably benign
IGL00953:Ube2j2 APN 4 155946377 intron probably benign
IGL01732:Ube2j2 APN 4 155957331 missense probably damaging 1.00
IGL02709:Ube2j2 APN 4 155957331 missense probably damaging 1.00
R1903:Ube2j2 UTSW 4 155949026 missense probably benign 0.13
R4630:Ube2j2 UTSW 4 155955258 missense probably damaging 0.98
R4632:Ube2j2 UTSW 4 155955258 missense probably damaging 0.98
R4999:Ube2j2 UTSW 4 155946384 start codon destroyed probably null
R5000:Ube2j2 UTSW 4 155946384 start codon destroyed probably null
R5249:Ube2j2 UTSW 4 155949058 missense possibly damaging 0.85
R7225:Ube2j2 UTSW 4 155949316 intron probably null
R7436:Ube2j2 UTSW 4 155957331 missense probably damaging 1.00
R7688:Ube2j2 UTSW 4 155956428 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCGTGTTACAGGTATGAAAGTGG -3'
(R):5'- ATTGACAGGCCTCTCGAGTG -3'

Sequencing Primer
(F):5'- GGGAAGTAGAGGCATTCACTG -3'
(R):5'- GTCCATCCACAGCTGAGGAGTTAC -3'
Posted On2015-06-10