Incidental Mutation 'R4172:Helq'
List |< first << previous [record 7 of 37] next >> last >|
ID318172
Institutional Source Beutler Lab
Gene Symbol Helq
Ensembl Gene ENSMUSG00000035266
Gene Namehelicase, POLQ-like
SynonymsD430018E21Rik, Hel308
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100762145-100798598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100771847 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 813 (K813E)
Ref Sequence ENSEMBL: ENSMUSP00000041599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044684]
Predicted Effect probably benign
Transcript: ENSMUST00000044684
AA Change: K813E

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000041599
Gene: ENSMUSG00000035266
AA Change: K813E

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
DEXDc 291 486 3.05e-17 SMART
HELICc 585 671 2.54e-14 SMART
low complexity region 812 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 1029 1042 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133845
AA Change: K811E
SMART Domains Protein: ENSMUSP00000116470
Gene: ENSMUSG00000035266
AA Change: K811E

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
DEXDc 290 485 3.05e-17 SMART
HELICc 584 670 2.54e-14 SMART
low complexity region 811 826 N/A INTRINSIC
low complexity region 932 945 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135102
Predicted Effect unknown
Transcript: ENSMUST00000155362
AA Change: K46E
SMART Domains Protein: ENSMUSP00000120806
Gene: ENSMUSG00000035266
AA Change: K46E

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HEL308 is a single-stranded DNA-dependent ATPase and DNA helicase (Marini and Wood, 2002 [PubMed 11751861]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced fertility and increased incident of tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Helq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Helq APN 5 100765082 unclassified probably benign
IGL02142:Helq APN 5 100783094 missense probably benign 0.01
IGL02172:Helq APN 5 100790147 missense probably damaging 1.00
IGL02234:Helq APN 5 100796470 missense possibly damaging 0.93
IGL03086:Helq APN 5 100796927 missense possibly damaging 0.60
R0083:Helq UTSW 5 100768368 nonsense probably null
R0108:Helq UTSW 5 100768368 nonsense probably null
R0276:Helq UTSW 5 100790147 missense probably damaging 1.00
R0359:Helq UTSW 5 100790200 missense probably benign 0.01
R0383:Helq UTSW 5 100779165 missense probably benign 0.28
R0554:Helq UTSW 5 100790200 missense probably benign 0.01
R1289:Helq UTSW 5 100796464 missense probably damaging 1.00
R1682:Helq UTSW 5 100792813 missense probably benign 0.41
R1800:Helq UTSW 5 100774124 missense probably benign 0.34
R1809:Helq UTSW 5 100773954 missense probably damaging 0.97
R1838:Helq UTSW 5 100771879 nonsense probably null
R3086:Helq UTSW 5 100773992 missense probably benign
R3439:Helq UTSW 5 100798304 missense probably damaging 0.97
R3735:Helq UTSW 5 100790188 missense possibly damaging 0.64
R3736:Helq UTSW 5 100790188 missense possibly damaging 0.64
R4835:Helq UTSW 5 100774163 missense possibly damaging 0.82
R4855:Helq UTSW 5 100783159 missense possibly damaging 0.89
R4908:Helq UTSW 5 100762641 splice site probably null
R4973:Helq UTSW 5 100792871 intron probably benign
R5561:Helq UTSW 5 100787050 missense probably benign 0.06
R5583:Helq UTSW 5 100762593 missense probably damaging 0.99
R5608:Helq UTSW 5 100790219 missense probably damaging 1.00
R5682:Helq UTSW 5 100785304 missense probably benign 0.04
R5875:Helq UTSW 5 100796470 missense probably damaging 1.00
R6302:Helq UTSW 5 100798439 missense probably damaging 0.96
R6344:Helq UTSW 5 100766728 missense probably benign 0.27
R6446:Helq UTSW 5 100768384 missense possibly damaging 0.64
R6825:Helq UTSW 5 100792695 missense probably damaging 1.00
R7260:Helq UTSW 5 100791927 missense probably damaging 1.00
R7323:Helq UTSW 5 100783185 frame shift probably null
R7535:Helq UTSW 5 100790133 splice site probably null
R7972:Helq UTSW 5 100792561 intron probably null
Predicted Primers PCR Primer
(F):5'- AGGTCACGTGACAAAGTCCAG -3'
(R):5'- TGTCCCTTAACGCTGAGGAAAC -3'

Sequencing Primer
(F):5'- CGTGACAAAGTCCAGAGAAGTCTC -3'
(R):5'- AATTCAAACTAATCCGAACTGGG -3'
Posted On2015-06-10