Incidental Mutation 'R4172:Trpv6'
List |< first << previous [record 33 of 37] next >> last >|
ID318173
Institutional Source Beutler Lab
Gene Symbol Trpv6
Ensembl Gene ENSMUSG00000029868
Gene Nametransient receptor potential cation channel, subfamily V, member 6
SynonymsCAT, Ecac2, CaT1, Cac
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41620624-41636405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41625498 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 318 (D318G)
Ref Sequence ENSEMBL: ENSMUSP00000143854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]
Predicted Effect probably damaging
Transcript: ENSMUST00000031902
AA Change: D318G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868
AA Change: D318G

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114732
SMART Domains Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
EPH_lbd 34 227 2.18e-100 SMART
low complexity region 242 255 N/A INTRINSIC
Pfam:GCC2_GCC3 299 341 1.9e-9 PFAM
FN3 365 462 3.59e-3 SMART
FN3 481 562 3.73e-10 SMART
Pfam:EphA2_TM 589 660 3.4e-16 PFAM
Pfam:Pkinase 663 908 1.4e-29 PFAM
Pfam:Pkinase_Tyr 663 908 1.1e-67 PFAM
SAM 938 1005 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194405
Predicted Effect probably damaging
Transcript: ENSMUST00000201471
AA Change: D318G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868
AA Change: D318G

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of multipass membrane proteins that functions as calcium channels. The encoded protein contains N-terminal ankyrin repeats, which are required for channel assembly and regulation. Translation initiation for this protein occurs at a non-AUG start codon that is decoded as methionine. This gene is situated next to a closely related gene for transient receptor potential cation channel subfamily V member 5 (TRPV5). This locus has experienced positive selection in non-African populations, resulting in several non-synonymous codon differences among individuals of different genetic backgrounds. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired sperm motility and decreased fertilization by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Trpv6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Trpv6 APN 6 41626867 splice site probably benign
IGL02033:Trpv6 APN 6 41627617 splice site probably benign
IGL02439:Trpv6 APN 6 41625487 missense probably damaging 1.00
R0973:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R0973:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R0974:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R1385:Trpv6 UTSW 6 41621129 missense probably benign 0.32
R1696:Trpv6 UTSW 6 41621768 missense possibly damaging 0.95
R2095:Trpv6 UTSW 6 41621756 missense probably damaging 0.99
R2287:Trpv6 UTSW 6 41626111 missense probably damaging 1.00
R2298:Trpv6 UTSW 6 41636076 missense possibly damaging 0.62
R2519:Trpv6 UTSW 6 41624616 nonsense probably null
R3522:Trpv6 UTSW 6 41627405 missense probably damaging 0.99
R4397:Trpv6 UTSW 6 41625238 missense possibly damaging 0.82
R4568:Trpv6 UTSW 6 41626569 missense probably damaging 1.00
R4571:Trpv6 UTSW 6 41621744 missense probably damaging 1.00
R5547:Trpv6 UTSW 6 41636154 missense possibly damaging 0.68
R6344:Trpv6 UTSW 6 41625422 splice site probably null
R6989:Trpv6 UTSW 6 41625456 missense probably damaging 1.00
R7427:Trpv6 UTSW 6 41625153 missense probably benign
R7445:Trpv6 UTSW 6 41621342 missense probably damaging 1.00
R7538:Trpv6 UTSW 6 41626167 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTACAGGTGTCTGGTCCAGG -3'
(R):5'- CTAGGATTTGGGTGGCATGCAC -3'

Sequencing Primer
(F):5'- CAGGTGTCTGGTCCAGGATCTG -3'
(R):5'- CCAAAGGCTGTGTTCTTTAAGAG -3'
Posted On2015-06-10