Incidental Mutation 'R4172:Spint2'
List |< first << previous [record 28 of 37] next >> last >|
ID318175
Institutional Source Beutler Lab
Gene Symbol Spint2
Ensembl Gene ENSMUSG00000074227
Gene Nameserine protease inhibitor, Kunitz type 2
SynonymsHAI-2
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29256323-29281912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29263672 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 67 (V67A)
Ref Sequence ENSEMBL: ENSMUSP00000096204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098604] [ENSMUST00000108236] [ENSMUST00000207601]
Predicted Effect probably damaging
Transcript: ENSMUST00000098604
AA Change: V67A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096204
Gene: ENSMUSG00000074227
AA Change: V67A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
KU 36 89 3.02e-23 SMART
KU 131 184 2.34e-20 SMART
transmembrane domain 198 220 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108236
SMART Domains Protein: ENSMUSP00000103871
Gene: ENSMUSG00000074227

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
KU 74 127 2.34e-20 SMART
transmembrane domain 141 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208585
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein with two extracellular Kunitz domains that inhibits a variety of serine proteases. The protein inhibits HGF activator which prevents the formation of active hepatocyte growth factor. This gene is a putative tumor suppressor, and mutations in this gene result in congenital sodium diarrhea. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous embryos carrying an insertional mutation fail to progress to the headfold stage and die at gastrulation displaying a severe clefting of the embryonic ectoderm at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Spint2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03373:Spint2 APN 7 29258209 splice site probably benign
R1754:Spint2 UTSW 7 29260366 splice site probably null
R1992:Spint2 UTSW 7 29259408 missense probably damaging 1.00
R4668:Spint2 UTSW 7 29260379 missense probably damaging 0.96
R4852:Spint2 UTSW 7 29256786 missense probably benign 0.25
R5299:Spint2 UTSW 7 29263726 missense probably damaging 1.00
R6501:Spint2 UTSW 7 29263706 missense probably damaging 1.00
R6746:Spint2 UTSW 7 29259423 missense probably benign 0.01
R7604:Spint2 UTSW 7 29258519 missense probably damaging 1.00
Z1176:Spint2 UTSW 7 29256822 missense not run
Z1177:Spint2 UTSW 7 29263660 missense not run
Predicted Primers PCR Primer
(F):5'- CTGTAGTGAAACCAGTGTGGC -3'
(R):5'- AGCTTGAACTTCCTCCTACAG -3'

Sequencing Primer
(F):5'- GGAACCAGCACACTAGTTCTG -3'
(R):5'- GAACTTCCTCCTACAGAGTATGTGTG -3'
Posted On2015-06-10