Incidental Mutation 'R4172:Paox'
ID318177
Institutional Source Beutler Lab
Gene Symbol Paox
Ensembl Gene ENSMUSG00000025464
Gene Namepolyamine oxidase (exo-N4-amino)
SynonymsPao, 2410012F02Rik
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140115799-140137224 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140134028 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 234 (G234R)
Ref Sequence ENSEMBL: ENSMUSP00000095580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026537] [ENSMUST00000036977] [ENSMUST00000097967] [ENSMUST00000124253] [ENSMUST00000211757]
Predicted Effect probably damaging
Transcript: ENSMUST00000026537
AA Change: G464R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026537
Gene: ENSMUSG00000025464
AA Change: G464R

DomainStartEndE-ValueType
Pfam:NAD_binding_8 10 79 4.1e-14 PFAM
Pfam:Amino_oxidase 15 490 4.9e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036977
SMART Domains Protein: ENSMUSP00000036491
Gene: ENSMUSG00000039018

DomainStartEndE-ValueType
SCOP:d1egaa1 31 129 5e-6 SMART
Pfam:FeoB_N 143 219 3.9e-6 PFAM
Pfam:MMR_HSR1 144 283 2.4e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097967
AA Change: G234R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095580
Gene: ENSMUSG00000025464
AA Change: G234R

DomainStartEndE-ValueType
Pfam:NAD_binding_8 10 77 1.4e-8 PFAM
Pfam:Amino_oxidase 52 260 1.5e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150667
Predicted Effect probably benign
Transcript: ENSMUST00000209908
Predicted Effect probably benign
Transcript: ENSMUST00000211171
Predicted Effect probably benign
Transcript: ENSMUST00000211757
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Paox
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0084:Paox UTSW 7 140132446 nonsense probably null
R0140:Paox UTSW 7 140134058 missense probably damaging 1.00
R0285:Paox UTSW 7 140129140 missense probably damaging 1.00
R0464:Paox UTSW 7 140129282 unclassified probably benign
R0546:Paox UTSW 7 140131678 missense probably damaging 1.00
R0733:Paox UTSW 7 140127527 missense probably damaging 0.99
R0926:Paox UTSW 7 140134038 missense probably damaging 1.00
R1169:Paox UTSW 7 140126331 missense probably benign 0.04
R1466:Paox UTSW 7 140129281 unclassified probably benign
R2260:Paox UTSW 7 140134054 nonsense probably null
R5914:Paox UTSW 7 140129188 missense probably damaging 1.00
R5951:Paox UTSW 7 140127654 missense probably damaging 1.00
R5960:Paox UTSW 7 140132489 missense probably benign 0.26
R6019:Paox UTSW 7 140131742 missense probably damaging 0.99
R6583:Paox UTSW 7 140126378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGTTTCTTAGCATTCACAGC -3'
(R):5'- AACGGGGCATCCATGATCAG -3'

Sequencing Primer
(F):5'- TAGCATTCACAGCTGCCTGG -3'
(R):5'- GGGCATCCATGATCAGACCAAG -3'
Posted On2015-06-10