Incidental Mutation 'R4172:Lcat'
ID318178
Institutional Source Beutler Lab
Gene Symbol Lcat
Ensembl Gene ENSMUSG00000035237
Gene Namelecithin cholesterol acyltransferase
SynonymsD8Wsu61e
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105939551-105943382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 105942427 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 72 (W72L)
Ref Sequence ENSEMBL: ENSMUSP00000038232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034369] [ENSMUST00000034370] [ENSMUST00000038896] [ENSMUST00000116429]
Predicted Effect probably benign
Transcript: ENSMUST00000034369
SMART Domains Protein: ENSMUSP00000034369
Gene: ENSMUSG00000031897

DomainStartEndE-ValueType
Pfam:Proteasome 36 217 3.9e-49 PFAM
Pfam:Pr_beta_C 231 267 3.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034370
SMART Domains Protein: ENSMUSP00000034370
Gene: ENSMUSG00000017765

DomainStartEndE-ValueType
low complexity region 97 117 N/A INTRINSIC
Pfam:AA_permease 125 318 5.8e-28 PFAM
Pfam:AA_permease 409 698 1.2e-40 PFAM
Pfam:SLC12 710 833 7.1e-18 PFAM
Pfam:SLC12 829 1087 4.8e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000038896
AA Change: W72L

PolyPhen 2 Score 0.556 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038232
Gene: ENSMUSG00000035237
AA Change: W72L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:LCAT 81 414 1.7e-111 PFAM
low complexity region 425 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116429
SMART Domains Protein: ENSMUSP00000112130
Gene: ENSMUSG00000017765

DomainStartEndE-ValueType
low complexity region 95 115 N/A INTRINSIC
Pfam:AA_permease 123 309 7.7e-29 PFAM
Pfam:AA_permease_2 390 654 2.9e-17 PFAM
Pfam:AA_permease 404 696 4.4e-39 PFAM
Pfam:KCl_Cotrans_1 953 982 9.2e-21 PFAM
low complexity region 1065 1080 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212876
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the extracellular cholesterol esterifying enzyme, lecithin-cholesterol acyltransferase. The esterification of cholesterol is required for cholesterol transport. Mutations in this gene have been found to cause fish-eye disease as well as LCAT deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes display severe hypoalphalipoproteinemia, variable hypertriglyceridemia, and accumulation of heterogeneous pre-beta HDL, as well as an attenuated increase in apoB-containing lipoproteins in response to dietary cholesterol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Lcat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02494:Lcat APN 8 105941939 unclassified probably benign
IGL02654:Lcat APN 8 105939769 missense possibly damaging 0.68
IGL02678:Lcat APN 8 105941940 splice site probably null
IGL02963:Lcat APN 8 105939956 missense probably damaging 0.99
IGL03304:Lcat APN 8 105940063 missense possibly damaging 0.94
R1754:Lcat UTSW 8 105941814 frame shift probably null
R1757:Lcat UTSW 8 105941814 frame shift probably null
R1824:Lcat UTSW 8 105939888 missense probably damaging 0.98
R1962:Lcat UTSW 8 105941723 missense probably damaging 0.98
R2866:Lcat UTSW 8 105939879 missense probably damaging 0.98
R4091:Lcat UTSW 8 105939906 missense probably benign 0.09
R4921:Lcat UTSW 8 105942442 missense possibly damaging 0.92
R5487:Lcat UTSW 8 105939664 missense probably benign
R6552:Lcat UTSW 8 105939679 missense possibly damaging 0.58
R7096:Lcat UTSW 8 105939677 missense possibly damaging 0.76
R7789:Lcat UTSW 8 105942225 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGATTCGGTCTTGCCAAAGCC -3'
(R):5'- AACCTTGAGGAGGGTGTACG -3'

Sequencing Primer
(F):5'- CAGAGCTGTGGTTGTAGACAATCC -3'
(R):5'- CCTTGAGGAGGGTGTACGAGATG -3'
Posted On2015-06-10