Incidental Mutation 'R4172:Zfp445'
List |< first << previous [record 37 of 37]
ID318183
Institutional Source Beutler Lab
Gene Symbol Zfp445
Ensembl Gene ENSMUSG00000047036
Gene Namezinc finger protein 445
SynonymsZNF168
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.574) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location122844529-122866006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122851937 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 980 (M980L)
Ref Sequence ENSEMBL: ENSMUSP00000151198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056467] [ENSMUST00000213971] [ENSMUST00000214626] [ENSMUST00000216063]
Predicted Effect probably benign
Transcript: ENSMUST00000056467
AA Change: M980L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000055738
Gene: ENSMUSG00000047036
AA Change: M980L

DomainStartEndE-ValueType
SCAN 48 160 1.07e-59 SMART
KRAB 219 278 6.74e-30 SMART
low complexity region 320 334 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
ZnF_C2H2 470 492 2.09e-3 SMART
ZnF_C2H2 498 520 3.16e-3 SMART
ZnF_C2H2 553 575 1.41e0 SMART
ZnF_C2H2 581 603 1.04e-3 SMART
ZnF_C2H2 634 656 1.6e-4 SMART
ZnF_C2H2 662 686 6.78e-3 SMART
ZnF_C2H2 718 740 1.67e-2 SMART
ZnF_C2H2 746 768 1.2e-3 SMART
ZnF_C2H2 796 818 2.02e-1 SMART
ZnF_C2H2 824 846 2.95e-3 SMART
ZnF_C2H2 933 955 2.49e-1 SMART
ZnF_C2H2 961 983 4.61e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213573
Predicted Effect probably benign
Transcript: ENSMUST00000213971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214162
Predicted Effect probably benign
Transcript: ENSMUST00000214626
Predicted Effect probably benign
Transcript: ENSMUST00000216063
AA Change: M980L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216243
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Other mutations in Zfp445
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02427:Zfp445 APN 9 122852230 missense probably benign 0.02
IGL02608:Zfp445 APN 9 122861875 missense probably damaging 0.98
IGL03216:Zfp445 APN 9 122851978 missense probably damaging 0.99
IGL03218:Zfp445 APN 9 122857529 missense probably benign 0.00
Nonpareil UTSW 9 122852345 missense probably benign 0.02
R0080:Zfp445 UTSW 9 122852356 missense probably damaging 0.98
R0082:Zfp445 UTSW 9 122852356 missense probably damaging 0.98
R0453:Zfp445 UTSW 9 122853513 missense possibly damaging 0.92
R0610:Zfp445 UTSW 9 122852981 missense probably benign 0.44
R0730:Zfp445 UTSW 9 122861758 missense probably damaging 1.00
R1622:Zfp445 UTSW 9 122852549 missense possibly damaging 0.90
R1719:Zfp445 UTSW 9 122852642 missense probably damaging 1.00
R2108:Zfp445 UTSW 9 122852240 missense probably benign 0.13
R2117:Zfp445 UTSW 9 122853437 nonsense probably null
R2143:Zfp445 UTSW 9 122853482 missense possibly damaging 0.70
R2162:Zfp445 UTSW 9 122852476 missense probably damaging 0.99
R3620:Zfp445 UTSW 9 122852768 missense probably benign
R3621:Zfp445 UTSW 9 122852768 missense probably benign
R3745:Zfp445 UTSW 9 122854726 missense probably benign 0.00
R3829:Zfp445 UTSW 9 122853077 missense probably benign
R3831:Zfp445 UTSW 9 122852476 missense probably damaging 0.99
R4180:Zfp445 UTSW 9 122852524 missense probably benign 0.00
R4747:Zfp445 UTSW 9 122857150 missense possibly damaging 0.81
R4923:Zfp445 UTSW 9 122852293 missense probably benign
R5010:Zfp445 UTSW 9 122852345 missense probably benign 0.02
R5578:Zfp445 UTSW 9 122853337 missense probably benign 0.00
R5759:Zfp445 UTSW 9 122853146 missense probably benign 0.00
R5864:Zfp445 UTSW 9 122853487 missense probably benign 0.00
R5865:Zfp445 UTSW 9 122853487 missense probably benign 0.00
R5987:Zfp445 UTSW 9 122853886 missense probably benign
R6481:Zfp445 UTSW 9 122857566 missense probably benign 0.00
R6738:Zfp445 UTSW 9 122862058 missense probably damaging 0.96
R6917:Zfp445 UTSW 9 122862294 intron probably null
R7137:Zfp445 UTSW 9 122854778 missense probably damaging 1.00
R7224:Zfp445 UTSW 9 122852143 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTAAAAGACCCCAGAGAACTTTCTG -3'
(R):5'- TGTGCCCACCAAGAAGAAAG -3'

Sequencing Primer
(F):5'- GAAGACTGAGAAATTCCTGAGTTTTG -3'
(R):5'- GAAAGCCTGCCACAAATGCAG -3'
Posted On2015-06-10