Incidental Mutation 'R4172:Rad51c'
List |< first << previous [record 22 of 37] next >> last >|
ID318187
Institutional Source Beutler Lab
Gene Symbol Rad51c
Ensembl Gene ENSMUSG00000007646
Gene NameRAD51 paralog C
SynonymsRad51l2
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87376645-87404954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87402746 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 77 (T77A)
Ref Sequence ENSEMBL: ENSMUSP00000064079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007790] [ENSMUST00000060835] [ENSMUST00000067692] [ENSMUST00000129400] [ENSMUST00000153073]
Predicted Effect probably damaging
Transcript: ENSMUST00000007790
AA Change: T95A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000007790
Gene: ENSMUSG00000007646
AA Change: T95A

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Rad51 91 359 1.7e-32 PFAM
Pfam:AAA_25 97 298 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060835
SMART Domains Protein: ENSMUSP00000054444
Gene: ENSMUSG00000010342

DomainStartEndE-ValueType
ANK 22 51 7.99e2 SMART
ANK 55 84 6.36e-3 SMART
ANK 88 117 3.49e0 SMART
Pfam:Pkinase 251 504 3.5e-19 PFAM
Pfam:Pkinase_Tyr 254 503 8.1e-28 PFAM
coiled coil region 659 684 N/A INTRINSIC
coiled coil region 740 776 N/A INTRINSIC
low complexity region 1219 1236 N/A INTRINSIC
coiled coil region 1289 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000067692
AA Change: T77A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064079
Gene: ENSMUSG00000007646
AA Change: T77A

DomainStartEndE-ValueType
Pfam:Rad51 73 341 1.9e-32 PFAM
Pfam:AAA_25 79 280 7.6e-10 PFAM
Pfam:KaiC 91 137 2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129400
AA Change: T77A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121928
Gene: ENSMUSG00000007646
AA Change: T77A

DomainStartEndE-ValueType
PDB:1PZN|G 10 125 2e-9 PDB
SCOP:d1g8ya_ 91 125 9e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000153073
AA Change: T77A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122811
Gene: ENSMUSG00000007646
AA Change: T77A

DomainStartEndE-ValueType
Pfam:Rad51 73 315 3.2e-28 PFAM
Pfam:AAA_25 79 280 2.1e-10 PFAM
Pfam:KaiC 91 137 1.7e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the RAD51 family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51 and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with other RAD51 paralogs and is reported to be important for Holliday junction resolution. Mutations in this gene are associated with Fanconi anemia-like syndrome. This gene is one of four localized to a region of chromosome 17q23 where amplification occurs frequently in breast tumors. Overexpression of the four genes during amplification has been observed and suggests a possible role in tumor progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality. Mice carrying a null and a hypomorphic allele have partial penetrance of male and female infertility due to defects in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Rad51c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Rad51c APN 11 87380855 missense possibly damaging 0.92
IGL03096:Rad51c APN 11 87388646 missense probably damaging 1.00
IGL03493:Rad51c APN 11 87397753 missense probably benign 0.00
R0415:Rad51c UTSW 11 87397655 missense probably damaging 0.99
R1875:Rad51c UTSW 11 87388643 missense probably damaging 0.99
R2098:Rad51c UTSW 11 87402763 missense probably benign
R4798:Rad51c UTSW 11 87395378 missense probably damaging 1.00
R5054:Rad51c UTSW 11 87397754 missense probably benign 0.06
R5182:Rad51c UTSW 11 87397719 missense possibly damaging 0.85
R5381:Rad51c UTSW 11 87397633 missense probably benign 0.00
R6087:Rad51c UTSW 11 87380879 missense probably benign 0.02
R7066:Rad51c UTSW 11 87402676 missense possibly damaging 0.56
R7714:Rad51c UTSW 11 87401450 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGGGAACGTCCTATTTTACC -3'
(R):5'- GGTTTTGATTCCCCAACTGC -3'

Sequencing Primer
(F):5'- GGGAACGTCCTATTTTACCATAACTG -3'
(R):5'- CTGGAACTCGATCTGTAGACCATG -3'
Posted On2015-06-10