Incidental Mutation 'R4172:Ighv7-4'
ID318190
Institutional Source Beutler Lab
Gene Symbol Ighv7-4
Ensembl Gene ENSMUSG00000076668
Gene Nameimmunoglobulin heavy variable 7-4
SynonymsGm16839
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location114222788-114223328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114223015 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 46 (F46I)
Ref Sequence ENSEMBL: ENSMUSP00000142041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103477] [ENSMUST00000192499]
Predicted Effect probably damaging
Transcript: ENSMUST00000103477
AA Change: F45I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100258
Gene: ENSMUSG00000076668
AA Change: F45I

DomainStartEndE-ValueType
IGv 35 118 1.18e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192499
AA Change: F46I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142041
Gene: ENSMUSG00000076668
AA Change: F46I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 119 4.9e-35 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Ighv7-4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Ighv7-4 APN 12 114223033 missense probably damaging 1.00
R4801:Ighv7-4 UTSW 12 114223279 start gained probably benign
R4802:Ighv7-4 UTSW 12 114223279 start gained probably benign
R6193:Ighv7-4 UTSW 12 114222825 missense possibly damaging 0.82
R6540:Ighv7-4 UTSW 12 114222850 missense possibly damaging 0.49
R6725:Ighv7-4 UTSW 12 114222869 missense probably damaging 1.00
Z1088:Ighv7-4 UTSW 12 114222897 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCTCAGGGTGTTCATTTG -3'
(R):5'- ACCATGAAGTTGTGGGTGAACTG -3'

Sequencing Primer
(F):5'- CCCTCAGGGTGTTCATTTGAAGATAG -3'
(R):5'- GTGAACTGGATTCTACTTGTAGCAC -3'
Posted On2015-06-10