Incidental Mutation 'R4172:Oxsm'
ID318192
Institutional Source Beutler Lab
Gene Symbol Oxsm
Ensembl Gene ENSMUSG00000021786
Gene Name3-oxoacyl-ACP synthase, mitochondrial
Synonyms4933425A18Rik
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4172 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location16238652-16249808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16242079 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 230 (V230E)
Ref Sequence ENSEMBL: ENSMUSP00000108244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022311] [ENSMUST00000112624] [ENSMUST00000112625]
Predicted Effect probably damaging
Transcript: ENSMUST00000022311
AA Change: V230E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022311
Gene: ENSMUSG00000021786
AA Change: V230E

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 291 6.7e-61 PFAM
Pfam:Ketoacyl-synt_C 299 414 3.6e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112624
AA Change: V230E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108243
Gene: ENSMUSG00000021786
AA Change: V230E

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 291 2.8e-60 PFAM
Pfam:Ketoacyl-synt_C 299 414 1.7e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112625
AA Change: V230E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108244
Gene: ENSMUSG00000021786
AA Change: V230E

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 291 2.8e-60 PFAM
Pfam:Ketoacyl-synt_C 299 414 1.7e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148121
SMART Domains Protein: ENSMUSP00000122364
Gene: ENSMUSG00000021786

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 198 9.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225889
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta-ketoacyl synthetase. The encoded enzyme is required for elongation of fatty acid chains in the mitochondria. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gfra2 C A 14: 70,896,081 T117K possibly damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Oxsm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Oxsm APN 14 16242076 missense probably damaging 1.00
IGL00900:Oxsm APN 14 16242023 missense probably damaging 0.96
IGL01966:Oxsm APN 14 16242520 missense probably benign
R0731:Oxsm UTSW 14 16240893 missense probably damaging 1.00
R2070:Oxsm UTSW 14 16241983 missense probably benign 0.03
R2071:Oxsm UTSW 14 16241983 missense probably benign 0.03
R5473:Oxsm UTSW 14 16242045 missense probably damaging 1.00
R6048:Oxsm UTSW 14 16242308 missense possibly damaging 0.63
R6301:Oxsm UTSW 14 16242220 missense probably damaging 1.00
R6415:Oxsm UTSW 14 16241904 missense probably benign 0.12
R6662:Oxsm UTSW 14 16242287 missense probably benign 0.02
R7490:Oxsm UTSW 14 16241066 missense probably benign 0.34
R7782:Oxsm UTSW 14 16240925 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GAGCTCCTCTCTGAACAGCATG -3'
(R):5'- AACTGCTTTGCTGTTTCAGACC -3'

Sequencing Primer
(F):5'- GAACAGCATGCTCATGTTCTTCCAG -3'
(R):5'- CTTTGCTGTTTCAGACCAAAGG -3'
Posted On2015-06-10