Incidental Mutation 'R4172:Gfra2'
ID318193
Institutional Source Beutler Lab
Gene Symbol Gfra2
Ensembl Gene ENSMUSG00000022103
Gene Nameglial cell line derived neurotrophic factor family receptor alpha 2
SynonymsGFR alpha-2, GFR alpha 2
MMRRC Submission 044391-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R4172 (G1)
Quality Score213
Status Not validated
Chromosome14
Chromosomal Location70890120-70979838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70896081 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 117 (T117K)
Ref Sequence ENSEMBL: ENSMUSP00000022699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022699] [ENSMUST00000227697]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022699
AA Change: T117K

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022699
Gene: ENSMUSG00000022103
AA Change: T117K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
GDNF 40 117 1.76e-15 SMART
GDNF 161 241 3.7e-23 SMART
GDNF 251 347 1.74e-28 SMART
low complexity region 381 397 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227697
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the receptor complex that transduces glial cell-derived neurotrophic factor and neurturin signals by mediating autophosphorylation and activation of the RET receptor. Mice lacking this protein are viable and fertile but display growth retardation attributed to impaired salivary and pancreatic secretion and innervation deficits in the intestinal tract. In addition, knockout mice display neural defects including a failure to initiate outgrowth of dorsal ganglion root neurons, demonstrating a requirement in neuronal differentiation of these cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutants have dry eyes, poor postweaning growth associated with impaired parasympathetic cholinergic innervation of lacrimal and salivary glands and of small intestine, reduced skin thickness and accelerated hair follicle regression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdc5l A G 17: 45,419,772 I196T probably damaging Het
Dnah7b G T 1: 46,226,946 R2225L probably damaging Het
Gle1 T C 2: 29,938,526 I120T probably benign Het
Guf1 T A 5: 69,558,229 N52K possibly damaging Het
Helq T C 5: 100,771,847 K813E probably benign Het
Ighv7-4 A T 12: 114,223,015 F46I probably damaging Het
Il6st G A 13: 112,495,327 D467N probably benign Het
Jak1 C A 4: 101,159,132 V812L probably benign Het
Kank4 G T 4: 98,779,121 T363K probably damaging Het
Lcat C A 8: 105,942,427 W72L possibly damaging Het
Map2 T C 1: 66,413,600 S392P possibly damaging Het
Mtmr2 T C 9: 13,800,062 F456L probably damaging Het
Myh8 A T 11: 67,292,421 R709W probably damaging Het
Nop14 T C 5: 34,650,607 N337S probably damaging Het
Npbwr1 A G 1: 5,916,936 Y120H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Oxsm A T 14: 16,242,079 V230E probably damaging Het
Paox G A 7: 140,134,028 G234R probably damaging Het
Polq C T 16: 37,060,758 H1095Y probably benign Het
Rad51c T C 11: 87,402,746 T77A probably damaging Het
Ryr3 C A 2: 112,794,470 V2202F probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Snx27 T C 3: 94,503,487 H452R probably benign Het
Son C T 16: 91,659,362 H1666Y probably damaging Het
Spata25 C A 2: 164,827,488 W201L possibly damaging Het
Spint2 A G 7: 29,263,672 V67A probably damaging Het
Srgap1 T C 10: 121,855,363 Y322C probably benign Het
Synm T C 7: 67,735,361 Y409C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tpm1 T C 9: 67,023,367 N283D probably benign Het
Trpv6 T C 6: 41,625,498 D318G probably damaging Het
Ube2j2 A G 4: 155,949,086 D39G probably damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Vwa5a T C 9: 38,723,870 F224L probably damaging Het
Zfp445 T A 9: 122,851,937 M980L probably benign Het
Other mutations in Gfra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Gfra2 APN 14 70968239 splice site probably benign
IGL01303:Gfra2 APN 14 70895852 missense probably benign 0.09
IGL01380:Gfra2 APN 14 70967146 splice site probably benign
IGL01528:Gfra2 APN 14 70966298 missense possibly damaging 0.95
IGL02203:Gfra2 APN 14 70967084 missense possibly damaging 0.69
IGL02270:Gfra2 APN 14 70925907 missense possibly damaging 0.78
IGL03104:Gfra2 APN 14 70968285 missense probably benign 0.00
IGL03270:Gfra2 APN 14 70925904 missense possibly damaging 0.80
H8562:Gfra2 UTSW 14 70978378 missense possibly damaging 0.94
H8786:Gfra2 UTSW 14 70978378 missense possibly damaging 0.94
R0423:Gfra2 UTSW 14 70896081 missense probably damaging 1.00
R4120:Gfra2 UTSW 14 70966275 missense probably damaging 1.00
R4712:Gfra2 UTSW 14 70925937 missense probably damaging 1.00
R4804:Gfra2 UTSW 14 70925921 missense possibly damaging 0.76
R4902:Gfra2 UTSW 14 70967015 missense probably damaging 1.00
R5424:Gfra2 UTSW 14 70895847 missense probably damaging 1.00
R6711:Gfra2 UTSW 14 70966275 missense probably damaging 1.00
R7290:Gfra2 UTSW 14 70925940 missense probably damaging 1.00
R7322:Gfra2 UTSW 14 70968391 missense probably benign 0.00
R7814:Gfra2 UTSW 14 70895970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCAACTGCAGCTCCAGG -3'
(R):5'- AGCCCGTCATCCAGTTCATC -3'

Sequencing Primer
(F):5'- AACTGCAGCTCCAGGTACCG -3'
(R):5'- GTCATCCAGTTCATCCTCTACCCTG -3'
Posted On2015-06-10