Incidental Mutation 'R4173:Xkr4'
ID318198
Institutional Source Beutler Lab
Gene Symbol Xkr4
Ensembl Gene ENSMUSG00000051951
Gene NameX-linked Kx blood group related 4
Synonyms
MMRRC Submission 041012-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4173 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location3205901-3671498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3216488 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 493 (F493S)
Ref Sequence ENSEMBL: ENSMUSP00000070648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070533]
Predicted Effect probably damaging
Transcript: ENSMUST00000070533
AA Change: F493S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070648
Gene: ENSMUSG00000051951
AA Change: F493S

DomainStartEndE-ValueType
low complexity region 49 99 N/A INTRINSIC
Pfam:XK-related 111 513 2.6e-128 PFAM
low complexity region 573 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162897
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdk1 T C 10: 69,345,161 D73G probably benign Het
Cspg4 A G 9: 56,887,930 E983G probably damaging Het
Gnmt A G 17: 46,726,121 V217A probably damaging Het
Myo5c A G 9: 75,246,258 E142G probably damaging Het
Nr1h5 C T 3: 102,952,230 R171H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Opcml C T 9: 28,903,358 T302I probably benign Het
Pcdha11 T C 18: 37,012,623 V589A probably damaging Het
Pigl T A 11: 62,458,511 F18I probably benign Het
Pip4k2b T C 11: 97,722,375 K265R probably benign Het
Rora C A 9: 68,653,910 T35K probably benign Het
Serpinb9e A G 13: 33,255,158 N189S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc25a45 C A 19: 5,880,583 Y99* probably null Het
Smgc T C 15: 91,860,561 S655P possibly damaging Het
Thbs2 A C 17: 14,681,631 probably null Het
Timd2 T C 11: 46,670,960 T286A probably benign Het
Trav6d-3 A G 14: 52,725,349 I14M probably benign Het
Trim28 A G 7: 13,029,878 D622G probably benign Het
Txnl4b G A 8: 109,569,074 V37I probably benign Het
Ubr1 C T 2: 120,946,622 probably null Het
Vps13c A G 9: 67,936,313 N1959D probably benign Het
Xrn2 T C 2: 147,047,692 V665A probably damaging Het
Other mutations in Xkr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03398:Xkr4 APN 1 3216575 missense probably damaging 1.00
R0200:Xkr4 UTSW 1 3670663 missense probably benign 0.00
R0829:Xkr4 UTSW 1 3671246 missense possibly damaging 0.59
R0830:Xkr4 UTSW 1 3670745 missense possibly damaging 0.48
R0959:Xkr4 UTSW 1 3216674 missense probably damaging 1.00
R1242:Xkr4 UTSW 1 3216137 missense probably damaging 1.00
R1257:Xkr4 UTSW 1 3216813 missense probably benign 0.29
R2002:Xkr4 UTSW 1 3671095 missense probably benign
R3896:Xkr4 UTSW 1 3216191 missense probably damaging 0.99
R4006:Xkr4 UTSW 1 3421775 missense probably benign 0.01
R4770:Xkr4 UTSW 1 3216491 missense probably damaging 1.00
R4868:Xkr4 UTSW 1 3216851 missense probably damaging 1.00
R5103:Xkr4 UTSW 1 3670688 missense probably benign
R5548:Xkr4 UTSW 1 3216930 missense probably damaging 1.00
R5602:Xkr4 UTSW 1 3216528 missense probably benign 0.18
R5608:Xkr4 UTSW 1 3671380 start gained probably benign
R5668:Xkr4 UTSW 1 3671035 missense probably damaging 1.00
R5901:Xkr4 UTSW 1 3216678 missense probably damaging 0.99
R6296:Xkr4 UTSW 1 3216570 missense probably benign 0.01
R6302:Xkr4 UTSW 1 3216738 missense probably damaging 0.99
R6326:Xkr4 UTSW 1 3671038 missense possibly damaging 0.75
R6341:Xkr4 UTSW 1 3670778 missense probably benign
R6911:Xkr4 UTSW 1 3671321 missense possibly damaging 0.91
R7086:Xkr4 UTSW 1 3216962 missense probably damaging 1.00
R7249:Xkr4 UTSW 1 3216810 missense probably damaging 1.00
R7571:Xkr4 UTSW 1 3670688 missense probably benign 0.00
R7881:Xkr4 UTSW 1 3216264 missense probably damaging 1.00
R7952:Xkr4 UTSW 1 3670619 missense possibly damaging 0.94
R8332:Xkr4 UTSW 1 3421899 missense probably damaging 1.00
Z1176:Xkr4 UTSW 1 3670981 missense probably damaging 1.00
Z1176:Xkr4 UTSW 1 3670982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACACTGCGGTTGTTGGAG -3'
(R):5'- TGGATTGTCCACTGTGAGACAG -3'

Sequencing Primer
(F):5'- GAGATGGACCGTAGTGTGC -3'
(R):5'- ACATGGTGGTGGGCATCATCTAC -3'
Posted On2015-06-10