Incidental Mutation 'R4173:Opcml'
ID318208
Institutional Source Beutler Lab
Gene Symbol Opcml
Ensembl Gene ENSMUSG00000062257
Gene Nameopioid binding protein/cell adhesion molecule-like
SynonymsObcam, B930023M13Rik, 2900075O15Rik, LOC235104
MMRRC Submission 041012-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4173 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location27790775-28925410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 28903358 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 302 (T302I)
Ref Sequence ENSEMBL: ENSMUSP00000110898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073822] [ENSMUST00000115243]
Predicted Effect probably benign
Transcript: ENSMUST00000073822
AA Change: T310I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073493
Gene: ENSMUSG00000062257
AA Change: T310I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 42 133 2.94e-10 SMART
IGc2 148 209 2.91e-14 SMART
IGc2 235 303 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115243
AA Change: T302I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110898
Gene: ENSMUSG00000062257
AA Change: T302I

DomainStartEndE-ValueType
IG 35 126 2.94e-10 SMART
IGc2 141 201 1.36e-14 SMART
IGc2 227 295 2e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215483
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cdk1 T C 10: 69,345,161 D73G probably benign Het
Cspg4 A G 9: 56,887,930 E983G probably damaging Het
Gnmt A G 17: 46,726,121 V217A probably damaging Het
Myo5c A G 9: 75,246,258 E142G probably damaging Het
Nr1h5 C T 3: 102,952,230 R171H probably damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Pcdha11 T C 18: 37,012,623 V589A probably damaging Het
Pigl T A 11: 62,458,511 F18I probably benign Het
Pip4k2b T C 11: 97,722,375 K265R probably benign Het
Rora C A 9: 68,653,910 T35K probably benign Het
Serpinb9e A G 13: 33,255,158 N189S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc25a45 C A 19: 5,880,583 Y99* probably null Het
Smgc T C 15: 91,860,561 S655P possibly damaging Het
Thbs2 A C 17: 14,681,631 probably null Het
Timd2 T C 11: 46,670,960 T286A probably benign Het
Trav6d-3 A G 14: 52,725,349 I14M probably benign Het
Trim28 A G 7: 13,029,878 D622G probably benign Het
Txnl4b G A 8: 109,569,074 V37I probably benign Het
Ubr1 C T 2: 120,946,622 probably null Het
Vps13c A G 9: 67,936,313 N1959D probably benign Het
Xkr4 A G 1: 3,216,488 F493S probably damaging Het
Xrn2 T C 2: 147,047,692 V665A probably damaging Het
Other mutations in Opcml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Opcml APN 9 28901590 missense probably damaging 1.00
IGL00864:Opcml APN 9 28901591 missense probably damaging 1.00
IGL00956:Opcml APN 9 28675328 missense possibly damaging 0.86
IGL02391:Opcml APN 9 28675264 missense probably damaging 0.96
IGL03210:Opcml APN 9 28901537 missense probably damaging 0.99
R0373:Opcml UTSW 9 28813398 missense possibly damaging 0.48
R1037:Opcml UTSW 9 28903299 missense probably damaging 1.00
R1564:Opcml UTSW 9 28903316 missense probably damaging 1.00
R2094:Opcml UTSW 9 28901590 missense probably damaging 1.00
R2268:Opcml UTSW 9 28903355 missense possibly damaging 0.91
R2426:Opcml UTSW 9 28903367 critical splice donor site probably null
R2938:Opcml UTSW 9 27791386 start codon destroyed probably null 0.00
R3746:Opcml UTSW 9 28901530 missense possibly damaging 0.54
R4058:Opcml UTSW 9 28901588 missense probably damaging 1.00
R4882:Opcml UTSW 9 28901590 missense probably damaging 1.00
R5335:Opcml UTSW 9 28675325 missense possibly damaging 0.88
R7058:Opcml UTSW 9 28675211 nonsense probably null
R7559:Opcml UTSW 9 28903324 missense probably benign
R8050:Opcml UTSW 9 28813344 missense probably damaging 0.97
R8250:Opcml UTSW 9 28675270 missense probably damaging 1.00
Z1177:Opcml UTSW 9 28404377 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCCTTTGAGTGCCTGCTGC -3'
(R):5'- ATTACCTTGGACACATGACTGC -3'

Sequencing Primer
(F):5'- GAGTGCCTGCTGCTTCTCTTG -3'
(R):5'- ACAGGCCAAGCAGATTCT -3'
Posted On2015-06-10