Incidental Mutation 'R4174:Pirb'
ID318235
Institutional Source Beutler Lab
Gene Symbol Pirb
Ensembl Gene ENSMUSG00000058818
Gene Namepaired Ig-like receptor B
SynonymsLilrb3, Gp91
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4174 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location3711409-3720391 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 3716032 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078451]
Predicted Effect probably null
Transcript: ENSMUST00000078451
SMART Domains Protein: ENSMUSP00000077546
Gene: ENSMUSG00000058818

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 34 118 1.8e-3 SMART
IG 129 315 1.2e-4 SMART
IG_like 237 302 6.2e-4 SMART
IG_like 328 415 3.4e-2 SMART
IG_like 435 502 1e-2 SMART
IG 529 618 3.6e-5 SMART
low complexity region 624 637 N/A INTRINSIC
transmembrane domain 641 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155131
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in both B and T lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T C 1: 38,207,927 H859R probably damaging Het
Agap2 T C 10: 127,090,514 V876A probably damaging Het
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cep70 T C 9: 99,246,313 probably benign Het
Ddx23 G A 15: 98,658,251 S62F unknown Het
Gabrp A G 11: 33,568,092 I72T probably damaging Het
Gpsm2 C T 3: 108,702,509 A102T probably damaging Het
Metap2 A G 10: 93,879,565 C112R possibly damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Olfr901 T A 9: 38,431,020 I246K probably damaging Het
Pde12 A T 14: 26,668,989 D188E probably benign Het
Rreb1 T A 13: 37,930,150 L495Q possibly damaging Het
Slc12a5 T C 2: 164,979,490 I275T probably damaging Het
Tas2r122 A G 6: 132,711,876 I18T probably damaging Het
Tdrkh A G 3: 94,428,233 T378A possibly damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Zglp1 A G 9: 21,066,070 F150L possibly damaging Het
Other mutations in Pirb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pirb APN 7 3717406 missense probably damaging 0.99
IGL01744:Pirb APN 7 3717176 nonsense probably null
IGL01755:Pirb APN 7 3717170 missense probably benign 0.16
IGL02580:Pirb APN 7 3714206 splice site probably null
IGL02941:Pirb APN 7 3717378 missense probably damaging 1.00
R0394:Pirb UTSW 7 3719248 missense probably benign 0.08
R0680:Pirb UTSW 7 3717361 missense possibly damaging 0.94
R0787:Pirb UTSW 7 3717638 missense probably benign
R0790:Pirb UTSW 7 3717638 missense probably benign
R0832:Pirb UTSW 7 3717638 missense probably benign
R1124:Pirb UTSW 7 3719732 missense probably benign 0.02
R1178:Pirb UTSW 7 3717638 missense probably benign
R1180:Pirb UTSW 7 3717638 missense probably benign
R1181:Pirb UTSW 7 3717638 missense probably benign
R1281:Pirb UTSW 7 3717190 missense probably damaging 1.00
R1343:Pirb UTSW 7 3717638 missense probably benign
R1579:Pirb UTSW 7 3717638 missense probably benign
R1699:Pirb UTSW 7 3717638 missense probably benign
R1768:Pirb UTSW 7 3717190 missense probably damaging 1.00
R1909:Pirb UTSW 7 3714588 missense probably benign 0.33
R1965:Pirb UTSW 7 3717638 missense probably benign
R1966:Pirb UTSW 7 3717638 missense probably benign
R2004:Pirb UTSW 7 3717638 missense probably benign
R2305:Pirb UTSW 7 3712991 missense probably benign 0.00
R2931:Pirb UTSW 7 3717206 missense probably benign 0.08
R3858:Pirb UTSW 7 3717663 missense possibly damaging 0.54
R3928:Pirb UTSW 7 3717638 missense probably benign
R3938:Pirb UTSW 7 3717638 missense probably benign
R4119:Pirb UTSW 7 3717575 missense probably damaging 1.00
R4248:Pirb UTSW 7 3719298 missense probably damaging 1.00
R4827:Pirb UTSW 7 3717603 missense probably benign
R4828:Pirb UTSW 7 3717603 missense probably benign
R4829:Pirb UTSW 7 3717603 missense probably benign
R4830:Pirb UTSW 7 3717603 missense probably benign
R4870:Pirb UTSW 7 3712662 missense probably benign 0.00
R4909:Pirb UTSW 7 3719362 nonsense probably null
R5146:Pirb UTSW 7 3712621 utr 3 prime probably benign
R5244:Pirb UTSW 7 3716063 missense probably benign 0.32
R5323:Pirb UTSW 7 3716599 missense possibly damaging 0.85
R5921:Pirb UTSW 7 3716694 nonsense probably null
R6316:Pirb UTSW 7 3717823 missense probably damaging 1.00
R6502:Pirb UTSW 7 3717393 missense probably benign 0.00
R6811:Pirb UTSW 7 3719642 missense possibly damaging 0.91
R7216:Pirb UTSW 7 3716274 missense probably benign 0.00
R7275:Pirb UTSW 7 3716178 missense probably benign 0.00
R7327:Pirb UTSW 7 3717188 nonsense probably null
R7582:Pirb UTSW 7 3713818 critical splice donor site probably null
R7717:Pirb UTSW 7 3717783 missense not run
R7717:Pirb UTSW 7 3717801 missense not run
R7807:Pirb UTSW 7 3719865 missense possibly damaging 0.55
R7844:Pirb UTSW 7 3719411 nonsense probably null
R7927:Pirb UTSW 7 3719411 nonsense probably null
R8206:Pirb UTSW 7 3712906 critical splice donor site probably null
X0025:Pirb UTSW 7 3717268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACTGATAGTCGCTACTCCAAACC -3'
(R):5'- TTCTGTCCAAGGAGGGATCAG -3'

Sequencing Primer
(F):5'- TAGTCGCTACTCCAAACCTAGATTG -3'
(R):5'- GGATCAGCCCAGCAACC -3'
Posted On2015-06-10