Incidental Mutation 'R4174:Gabrp'
ID318241
Institutional Source Beutler Lab
Gene Symbol Gabrp
Ensembl Gene ENSMUSG00000020159
Gene Namegamma-aminobutyric acid (GABA) A receptor, pi
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4174 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location33550781-33578959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33568092 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 72 (I72T)
Ref Sequence ENSEMBL: ENSMUSP00000020366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020366] [ENSMUST00000135350]
Predicted Effect probably damaging
Transcript: ENSMUST00000020366
AA Change: I72T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020366
Gene: ENSMUSG00000020159
AA Change: I72T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Neur_chan_LBD 40 242 1.3e-49 PFAM
Pfam:Neur_chan_memb 249 353 5.2e-23 PFAM
transmembrane domain 420 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135350
SMART Domains Protein: ENSMUSP00000120500
Gene: ENSMUSG00000020159

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. The subunit encoded by this gene is expressed in several non-neuronal tissues including the uterus and ovaries. This subunit can assemble with known GABA A receptor subunits, and the presence of this subunit alters the sensitivity of recombinant receptors to modulatory agents such as pregnanolone. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 T C 1: 38,207,927 H859R probably damaging Het
Agap2 T C 10: 127,090,514 V876A probably damaging Het
Akip1 C T 7: 109,707,509 Q138* probably null Het
Cep70 T C 9: 99,246,313 probably benign Het
Ddx23 G A 15: 98,658,251 S62F unknown Het
Gpsm2 C T 3: 108,702,509 A102T probably damaging Het
Metap2 A G 10: 93,879,565 C112R possibly damaging Het
Olfr48 T G 2: 89,844,778 D65A probably damaging Het
Olfr901 T A 9: 38,431,020 I246K probably damaging Het
Pde12 A T 14: 26,668,989 D188E probably benign Het
Pirb A T 7: 3,716,032 probably null Het
Rreb1 T A 13: 37,930,150 L495Q possibly damaging Het
Slc12a5 T C 2: 164,979,490 I275T probably damaging Het
Tas2r122 A G 6: 132,711,876 I18T probably damaging Het
Tdrkh A G 3: 94,428,233 T378A possibly damaging Het
Ubr1 C T 2: 120,946,622 probably null Het
Zglp1 A G 9: 21,066,070 F150L possibly damaging Het
Other mutations in Gabrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gabrp APN 11 33552644 missense possibly damaging 0.91
IGL01299:Gabrp APN 11 33554476 missense probably damaging 1.00
IGL01305:Gabrp APN 11 33555055 missense probably damaging 1.00
IGL01686:Gabrp APN 11 33552826 nonsense probably null
IGL01729:Gabrp APN 11 33552689 missense probably damaging 1.00
IGL03031:Gabrp APN 11 33554980 missense probably damaging 1.00
IGL03172:Gabrp APN 11 33554388 missense probably damaging 1.00
IGL03280:Gabrp APN 11 33552616 missense probably benign 0.12
ANU22:Gabrp UTSW 11 33555055 missense probably damaging 1.00
R0265:Gabrp UTSW 11 33552614 missense probably damaging 1.00
R0326:Gabrp UTSW 11 33554362 missense probably damaging 0.99
R1744:Gabrp UTSW 11 33572462 missense probably benign 0.03
R5043:Gabrp UTSW 11 33568072 missense probably benign 0.00
R5213:Gabrp UTSW 11 33567211 critical splice donor site probably null
R5290:Gabrp UTSW 11 33567310 missense probably damaging 0.99
R5665:Gabrp UTSW 11 33554308 missense possibly damaging 0.56
R6698:Gabrp UTSW 11 33557017 missense probably damaging 1.00
Z1176:Gabrp UTSW 11 33552673 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCAGTCAATCGGTCACTTCC -3'
(R):5'- ACTAATGTAGATACACCGGCTG -3'

Sequencing Primer
(F):5'- TGTTCCCTTCCTGATACCCAGAAAAC -3'
(R):5'- TAGATGGAGGAGAGCTTGT -3'
Posted On2015-06-10