Incidental Mutation 'R4175:Ifi208'
ID318246
Institutional Source Beutler Lab
Gene Symbol Ifi208
Ensembl Gene ENSMUSG00000066677
Gene Nameinterferon activated gene 208
SynonymsPydc3, E430029J22Rik, Pyr-rv1
MMRRC Submission 041013-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4175 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173673675-173698395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 173682701 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 141 (M141L)
Ref Sequence ENSEMBL: ENSMUSP00000128958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085876] [ENSMUST00000169857]
Predicted Effect probably benign
Transcript: ENSMUST00000085876
AA Change: M141L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000083039
Gene: ENSMUSG00000066677
AA Change: M141L

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
low complexity region 488 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169857
AA Change: M141L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000128958
Gene: ENSMUSG00000066677
AA Change: M141L

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:HERV-K_REC 502 580 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182880
Meta Mutation Damage Score 0.0794 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd63 T C 2: 118,702,619 M274V probably benign Het
Ano6 A T 15: 95,962,169 D724V probably damaging Het
Apobec3 A G 15: 79,895,452 N43S probably damaging Het
Arfgef1 T C 1: 10,159,636 H1280R probably damaging Het
Cbfa2t3 C T 8: 122,643,318 V139M probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Clmp A T 9: 40,771,136 N72I probably benign Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
Creb3l1 A G 2: 91,983,175 F506L probably benign Het
Ctbp1 A G 5: 33,266,906 S47P probably damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dus1l G A 11: 120,795,680 R12C possibly damaging Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Epb41l4b A G 4: 57,076,556 V326A probably damaging Het
Fhdc1 T C 3: 84,456,987 probably benign Het
Gm27013 T A 6: 130,677,147 T451S probably benign Het
Inpp5e A G 2: 26,400,925 S377P probably damaging Het
Kat2a A G 11: 100,705,266 L822P probably damaging Het
Kcnip2 G C 19: 45,812,215 T24S probably benign Het
Med17 A G 9: 15,267,469 Y469H possibly damaging Het
Mindy3 C T 2: 12,405,865 C77Y probably damaging Het
Mmp1a A G 9: 7,467,235 T271A probably benign Het
Ncor2 A T 5: 125,050,956 S118T probably damaging Het
Olfr994 A T 2: 85,430,618 D70E probably damaging Het
Osmr A T 15: 6,852,546 V39D probably damaging Het
Pcdh15 G A 10: 74,631,997 probably benign Het
Pclo A G 5: 14,713,875 K836E probably damaging Het
Pik3r1 A T 13: 101,701,732 L272H probably damaging Het
Pik3r1 G A 13: 101,701,733 L272F probably benign Het
Prrc2b G GCT 2: 32,218,808 probably benign Het
Ptprq T G 10: 107,711,917 I207L probably benign Het
Rasa2 G T 9: 96,560,777 T531K probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a6 G A 9: 108,854,217 probably benign Het
Slc7a13 G A 4: 19,819,492 G231R probably null Het
Slco3a1 T A 7: 74,318,554 N473Y probably damaging Het
Tapt1 G A 5: 44,177,105 L515F probably benign Het
Tmem145 T C 7: 25,308,793 I253T probably benign Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Unc13a A G 8: 71,667,724 probably benign Het
Usp24 T C 4: 106,316,773 V101A probably benign Het
Zfp36l3 T C X: 53,775,873 T125A possibly damaging Het
Other mutations in Ifi208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ifi208 APN 1 173679038 critical splice donor site probably null
IGL00725:Ifi208 APN 1 173682861 missense possibly damaging 0.86
IGL01952:Ifi208 APN 1 173679031 missense possibly damaging 0.93
IGL02024:Ifi208 APN 1 173683290 missense probably damaging 0.99
IGL02637:Ifi208 APN 1 173678942 missense probably benign 0.15
IGL02829:Ifi208 APN 1 173682840 missense probably damaging 0.99
IGL03216:Ifi208 APN 1 173678941 missense possibly damaging 0.68
IGL03398:Ifi208 APN 1 173683251 missense probably damaging 0.96
FR4304:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4340:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4342:Ifi208 UTSW 1 173677698 small deletion probably benign
R0022:Ifi208 UTSW 1 173683046 missense possibly damaging 0.91
R0468:Ifi208 UTSW 1 173683481 missense probably benign 0.08
R0734:Ifi208 UTSW 1 173683335 missense probably damaging 0.98
R0780:Ifi208 UTSW 1 173682696 missense probably benign 0.06
R1070:Ifi208 UTSW 1 173683044 missense probably damaging 0.99
R1339:Ifi208 UTSW 1 173683238 missense probably damaging 0.99
R1473:Ifi208 UTSW 1 173695654 missense possibly damaging 0.53
R1755:Ifi208 UTSW 1 173677910 missense possibly damaging 0.86
R3012:Ifi208 UTSW 1 173695570 critical splice acceptor site probably null
R3692:Ifi208 UTSW 1 173682872 missense possibly damaging 0.93
R4235:Ifi208 UTSW 1 173682911 missense probably benign 0.06
R4749:Ifi208 UTSW 1 173695614 missense possibly damaging 0.70
R4815:Ifi208 UTSW 1 173682837 missense probably damaging 0.96
R5116:Ifi208 UTSW 1 173677983 intron probably benign
R5138:Ifi208 UTSW 1 173690673 missense probably null 0.29
R5210:Ifi208 UTSW 1 173683265 missense probably benign
R5304:Ifi208 UTSW 1 173683608 missense probably benign
R6126:Ifi208 UTSW 1 173677708 missense possibly damaging 0.91
R6558:Ifi208 UTSW 1 173683023 missense probably damaging 0.99
R6915:Ifi208 UTSW 1 173682878 missense probably damaging 1.00
R7513:Ifi208 UTSW 1 173695654 nonsense probably null
R7972:Ifi208 UTSW 1 173678990 missense possibly damaging 0.68
R8143:Ifi208 UTSW 1 173682676 missense possibly damaging 0.91
R8383:Ifi208 UTSW 1 173683509 missense possibly damaging 0.93
R8431:Ifi208 UTSW 1 173683278 missense possibly damaging 0.85
RF027:Ifi208 UTSW 1 173677696 small deletion probably benign
RF029:Ifi208 UTSW 1 173677696 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTGAAATTCAGTGTCCACG -3'
(R):5'- TGGTGCTGAAGAACCCTGAG -3'

Sequencing Primer
(F):5'- CAGTGTCCACGTTTCTAAGAGAC -3'
(R):5'- ACCCTGAGATGTTGCCAATATGG -3'
Posted On2015-06-10