Incidental Mutation 'R4175:Usp24'
ID 318256
Institutional Source Beutler Lab
Gene Symbol Usp24
Ensembl Gene ENSMUSG00000028514
Gene Name ubiquitin specific peptidase 24
Synonyms 2810030C21Rik, 2700066K03Rik
MMRRC Submission 041013-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4175 (G1)
Quality Score 184
Status Validated
Chromosome 4
Chromosomal Location 106316213-106441322 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106316773 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 101 (V101A)
Ref Sequence ENSEMBL: ENSMUSP00000133095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]
AlphaFold B1AY13
Predicted Effect probably benign
Transcript: ENSMUST00000094933
AA Change: V101A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: V101A

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 882 6e-7 SMART
low complexity region 1031 1059 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1365 1378 N/A INTRINSIC
Pfam:UCH 1685 2036 3.7e-54 PFAM
Pfam:UCH_1 1686 1993 1.8e-27 PFAM
low complexity region 2066 2081 N/A INTRINSIC
low complexity region 2256 2267 N/A INTRINSIC
low complexity region 2576 2592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106798
SMART Domains Protein: ENSMUSP00000102410
Gene: ENSMUSG00000028514

DomainStartEndE-ValueType
SCOP:d1ifya_ 3 47 2e-6 SMART
Blast:UBA 5 43 2e-17 BLAST
low complexity region 57 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165709
AA Change: V101A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: V101A

DomainStartEndE-ValueType
Blast:UBA 5 43 2e-16 BLAST
low complexity region 57 96 N/A INTRINSIC
SCOP:d1gw5a_ 348 883 8e-7 SMART
low complexity region 1032 1060 N/A INTRINSIC
low complexity region 1125 1151 N/A INTRINSIC
low complexity region 1366 1379 N/A INTRINSIC
Pfam:UCH 1686 2037 2e-49 PFAM
Pfam:UCH_1 1687 1994 4e-24 PFAM
low complexity region 2067 2082 N/A INTRINSIC
low complexity region 2257 2268 N/A INTRINSIC
low complexity region 2577 2593 N/A INTRINSIC
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd63 T C 2: 118,702,619 M274V probably benign Het
Ano6 A T 15: 95,962,169 D724V probably damaging Het
Apobec3 A G 15: 79,895,452 N43S probably damaging Het
Arfgef1 T C 1: 10,159,636 H1280R probably damaging Het
Cbfa2t3 C T 8: 122,643,318 V139M probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Clmp A T 9: 40,771,136 N72I probably benign Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
Creb3l1 A G 2: 91,983,175 F506L probably benign Het
Ctbp1 A G 5: 33,266,906 S47P probably damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dus1l G A 11: 120,795,680 R12C possibly damaging Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Epb41l4b A G 4: 57,076,556 V326A probably damaging Het
Fhdc1 T C 3: 84,456,987 probably benign Het
Gm27013 T A 6: 130,677,147 T451S probably benign Het
Ifi208 A T 1: 173,682,701 M141L probably benign Het
Inpp5e A G 2: 26,400,925 S377P probably damaging Het
Kat2a A G 11: 100,705,266 L822P probably damaging Het
Kcnip2 G C 19: 45,812,215 T24S probably benign Het
Med17 A G 9: 15,267,469 Y469H possibly damaging Het
Mindy3 C T 2: 12,405,865 C77Y probably damaging Het
Mmp1a A G 9: 7,467,235 T271A probably benign Het
Ncor2 A T 5: 125,050,956 S118T probably damaging Het
Olfr994 A T 2: 85,430,618 D70E probably damaging Het
Osmr A T 15: 6,852,546 V39D probably damaging Het
Pcdh15 G A 10: 74,631,997 probably benign Het
Pclo A G 5: 14,713,875 K836E probably damaging Het
Pik3r1 A T 13: 101,701,732 L272H probably damaging Het
Pik3r1 G A 13: 101,701,733 L272F probably benign Het
Prrc2b G GCT 2: 32,218,808 probably benign Het
Ptprq T G 10: 107,711,917 I207L probably benign Het
Rasa2 G T 9: 96,560,777 T531K probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a6 G A 9: 108,854,217 probably benign Het
Slc7a13 G A 4: 19,819,492 G231R probably null Het
Slco3a1 T A 7: 74,318,554 N473Y probably damaging Het
Tapt1 G A 5: 44,177,105 L515F probably benign Het
Tmem145 T C 7: 25,308,793 I253T probably benign Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Unc13a A G 8: 71,667,724 probably benign Het
Zfp36l3 T C X: 53,775,873 T125A possibly damaging Het
Other mutations in Usp24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Usp24 APN 4 106359091 missense probably benign
IGL00340:Usp24 APN 4 106401139 missense probably damaging 0.99
IGL00480:Usp24 APN 4 106368106 missense probably damaging 0.99
IGL00548:Usp24 APN 4 106341298 missense probably damaging 0.96
IGL00655:Usp24 APN 4 106390318 missense probably damaging 0.99
IGL00674:Usp24 APN 4 106372679 splice site probably benign
IGL00718:Usp24 APN 4 106409704 missense probably benign 0.10
IGL00803:Usp24 APN 4 106385526 splice site probably benign
IGL01161:Usp24 APN 4 106436844 missense probably benign 0.02
IGL01344:Usp24 APN 4 106379385 missense possibly damaging 0.73
IGL01374:Usp24 APN 4 106380099 missense possibly damaging 0.86
IGL01485:Usp24 APN 4 106362232 missense probably benign 0.01
IGL01736:Usp24 APN 4 106423461 missense probably benign 0.00
IGL01737:Usp24 APN 4 106387734 missense probably benign 0.03
IGL01862:Usp24 APN 4 106408898 splice site probably benign
IGL01981:Usp24 APN 4 106375768 splice site probably benign
IGL02090:Usp24 APN 4 106411426 missense possibly damaging 0.55
IGL02275:Usp24 APN 4 106387493 missense probably damaging 1.00
IGL02352:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02359:Usp24 APN 4 106403925 missense probably damaging 1.00
IGL02391:Usp24 APN 4 106407129 missense possibly damaging 0.60
IGL02418:Usp24 APN 4 106436360 missense probably benign 0.07
IGL02537:Usp24 APN 4 106392367 missense probably damaging 1.00
IGL02638:Usp24 APN 4 106438770 splice site probably benign
IGL02638:Usp24 APN 4 106438772 splice site probably benign
IGL02830:Usp24 APN 4 106347387 missense possibly damaging 0.79
IGL03125:Usp24 APN 4 106392402 missense probably benign 0.09
IGL03280:Usp24 APN 4 106380430 missense probably damaging 1.00
IGL03350:Usp24 APN 4 106371079 nonsense probably null
BB010:Usp24 UTSW 4 106428489 missense probably benign
BB020:Usp24 UTSW 4 106428489 missense probably benign
IGL03098:Usp24 UTSW 4 106371033 missense probably benign 0.11
R0035:Usp24 UTSW 4 106368027 missense probably benign 0.18
R0044:Usp24 UTSW 4 106412084 splice site probably benign
R0086:Usp24 UTSW 4 106392360 missense probably damaging 0.98
R0125:Usp24 UTSW 4 106397299 missense possibly damaging 0.76
R0197:Usp24 UTSW 4 106407133 missense probably damaging 1.00
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0240:Usp24 UTSW 4 106414404 nonsense probably null
R0491:Usp24 UTSW 4 106402105 missense probably benign 0.41
R0687:Usp24 UTSW 4 106420504 missense probably damaging 1.00
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0973:Usp24 UTSW 4 106413678 splice site probably null
R0973:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106371079 nonsense probably null
R0974:Usp24 UTSW 4 106413678 splice site probably null
R1163:Usp24 UTSW 4 106420960 missense probably benign
R1293:Usp24 UTSW 4 106423553 missense probably benign 0.19
R1333:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R1476:Usp24 UTSW 4 106361933 missense probably damaging 1.00
R1699:Usp24 UTSW 4 106438827 missense probably damaging 0.99
R1728:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1729:Usp24 UTSW 4 106360421 missense possibly damaging 0.85
R1753:Usp24 UTSW 4 106377559 missense probably benign 0.04
R1917:Usp24 UTSW 4 106410286 missense probably damaging 1.00
R2045:Usp24 UTSW 4 106400980 missense possibly damaging 0.54
R2424:Usp24 UTSW 4 106399113 critical splice donor site probably null
R2436:Usp24 UTSW 4 106409645 nonsense probably null
R2513:Usp24 UTSW 4 106379405 splice site probably null
R3824:Usp24 UTSW 4 106379066 missense probably benign
R3831:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3833:Usp24 UTSW 4 106362012 critical splice donor site probably null
R3982:Usp24 UTSW 4 106387883 missense probably benign 0.38
R4022:Usp24 UTSW 4 106379224 splice site probably benign
R4067:Usp24 UTSW 4 106359089 missense possibly damaging 0.68
R4766:Usp24 UTSW 4 106416048 missense probably damaging 1.00
R4771:Usp24 UTSW 4 106362180 splice site probably null
R4798:Usp24 UTSW 4 106360162 missense possibly damaging 0.82
R4809:Usp24 UTSW 4 106413676 critical splice donor site probably null
R4822:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R4906:Usp24 UTSW 4 106388637 missense probably benign 0.20
R4934:Usp24 UTSW 4 106426546 missense probably benign 0.29
R5074:Usp24 UTSW 4 106420447 missense probably benign 0.12
R5151:Usp24 UTSW 4 106399112 critical splice donor site probably null
R5220:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R5279:Usp24 UTSW 4 106385424 missense possibly damaging 0.94
R5280:Usp24 UTSW 4 106341214 missense probably benign 0.18
R5285:Usp24 UTSW 4 106407033 missense probably benign 0.00
R5292:Usp24 UTSW 4 106418263 missense probably benign 0.06
R5294:Usp24 UTSW 4 106362357 missense possibly damaging 0.53
R5394:Usp24 UTSW 4 106408013 missense probably damaging 1.00
R5517:Usp24 UTSW 4 106375674 missense probably benign 0.02
R5522:Usp24 UTSW 4 106372721 missense probably damaging 1.00
R5546:Usp24 UTSW 4 106416047 missense probably damaging 0.98
R5756:Usp24 UTSW 4 106362483 missense probably damaging 1.00
R5910:Usp24 UTSW 4 106380468 missense probably damaging 0.99
R5972:Usp24 UTSW 4 106368067 missense probably damaging 0.98
R6285:Usp24 UTSW 4 106374100 splice site probably null
R6370:Usp24 UTSW 4 106380521 missense probably null 0.20
R6630:Usp24 UTSW 4 106387835 missense possibly damaging 0.69
R6754:Usp24 UTSW 4 106360420 missense probably damaging 1.00
R7027:Usp24 UTSW 4 106362244 missense probably benign 0.21
R7088:Usp24 UTSW 4 106387546 missense probably damaging 1.00
R7129:Usp24 UTSW 4 106362215 missense probably damaging 1.00
R7131:Usp24 UTSW 4 106382303 missense possibly damaging 0.69
R7156:Usp24 UTSW 4 106387919 critical splice donor site probably null
R7174:Usp24 UTSW 4 106362681 splice site probably null
R7236:Usp24 UTSW 4 106406305 splice site probably null
R7403:Usp24 UTSW 4 106407035 missense possibly damaging 0.79
R7424:Usp24 UTSW 4 106379107 missense probably benign 0.00
R7475:Usp24 UTSW 4 106342353 missense possibly damaging 0.55
R7505:Usp24 UTSW 4 106379079 missense probably damaging 1.00
R7782:Usp24 UTSW 4 106316574 missense probably damaging 1.00
R7900:Usp24 UTSW 4 106409400 missense probably damaging 1.00
R7933:Usp24 UTSW 4 106428489 missense probably benign
R7940:Usp24 UTSW 4 106430544 missense probably damaging 0.98
R8271:Usp24 UTSW 4 106428514 missense probably damaging 0.98
R8348:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8448:Usp24 UTSW 4 106368736 missense possibly damaging 0.82
R8483:Usp24 UTSW 4 106373756 missense probably damaging 1.00
R8546:Usp24 UTSW 4 106402129 missense probably benign 0.01
R8798:Usp24 UTSW 4 106379239 missense probably benign 0.00
R8822:Usp24 UTSW 4 106412213 missense probably benign 0.17
R8992:Usp24 UTSW 4 106377565 missense probably benign 0.36
R9002:Usp24 UTSW 4 106418215 missense possibly damaging 0.72
R9037:Usp24 UTSW 4 106379054 missense probably damaging 0.99
R9068:Usp24 UTSW 4 106375678 missense probably benign 0.09
R9096:Usp24 UTSW 4 106397311 missense probably benign 0.00
R9180:Usp24 UTSW 4 106359050 missense possibly damaging 0.71
R9199:Usp24 UTSW 4 106387484 missense probably damaging 1.00
R9201:Usp24 UTSW 4 106420530 missense probably benign 0.36
R9251:Usp24 UTSW 4 106360518 missense probably benign 0.19
R9423:Usp24 UTSW 4 106431670 missense probably damaging 1.00
R9459:Usp24 UTSW 4 106342358 missense probably damaging 1.00
R9472:Usp24 UTSW 4 106403931 missense probably benign 0.00
R9483:Usp24 UTSW 4 106362182 missense probably damaging 0.99
R9534:Usp24 UTSW 4 106407115 missense probably damaging 0.97
R9653:Usp24 UTSW 4 106347367 missense probably benign 0.03
R9712:Usp24 UTSW 4 106347367 missense probably benign 0.03
X0024:Usp24 UTSW 4 106360446 missense probably benign 0.09
X0028:Usp24 UTSW 4 106368055 missense probably benign 0.01
X0066:Usp24 UTSW 4 106355731 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCCTGGCCAAGAACGACATC -3'
(R):5'- TCTAGTGACCCCGATCTCG -3'

Sequencing Primer
(F):5'- TGGCGCTGCTCACCAAC -3'
(R):5'- CGATCTCGGACCAGAACTG -3'
Posted On 2015-06-10