Incidental Mutation 'R4175:Gm27013'
ID318261
Institutional Source Beutler Lab
Gene Symbol Gm27013
Ensembl Gene ENSMUSG00000098025
Gene Namepredicted gene, 27013
Synonyms
MMRRC Submission 041013-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R4175 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location130519764-130546306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130677147 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 451 (T451S)
Gene Model predicted gene model for transcript(s):
Predicted Effect probably benign
Transcript: ENSMUST00000182643
AA Change: T451S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138716
Gene: ENSMUSG00000098137
AA Change: T451S

DomainStartEndE-ValueType
KRAB 8 68 3.39e-35 SMART
ZnF_C2H2 453 503 1.83e2 SMART
ZnF_C2H2 509 531 6.99e-5 SMART
ZnF_C2H2 537 559 1.4e-4 SMART
ZnF_C2H2 565 587 1.6e-4 SMART
ZnF_C2H2 593 615 1.08e-5 SMART
ZnF_C2H2 621 643 1.2e-3 SMART
ZnF_C2H2 649 671 1.5e-4 SMART
ZnF_C2H2 677 699 1.58e-3 SMART
ZnF_C2H2 705 727 2.61e-4 SMART
ZnF_C2H2 733 755 4.79e-3 SMART
ZnF_C2H2 761 783 4.61e-5 SMART
ZnF_C2H2 789 811 1.13e-4 SMART
ZnF_C2H2 817 839 3.16e-3 SMART
ZnF_C2H2 845 867 1.28e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205067
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd63 T C 2: 118,702,619 M274V probably benign Het
Ano6 A T 15: 95,962,169 D724V probably damaging Het
Apobec3 A G 15: 79,895,452 N43S probably damaging Het
Arfgef1 T C 1: 10,159,636 H1280R probably damaging Het
Cbfa2t3 C T 8: 122,643,318 V139M probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Clmp A T 9: 40,771,136 N72I probably benign Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
Creb3l1 A G 2: 91,983,175 F506L probably benign Het
Ctbp1 A G 5: 33,266,906 S47P probably damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dus1l G A 11: 120,795,680 R12C possibly damaging Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Epb41l4b A G 4: 57,076,556 V326A probably damaging Het
Fhdc1 T C 3: 84,456,987 probably benign Het
Ifi208 A T 1: 173,682,701 M141L probably benign Het
Inpp5e A G 2: 26,400,925 S377P probably damaging Het
Kat2a A G 11: 100,705,266 L822P probably damaging Het
Kcnip2 G C 19: 45,812,215 T24S probably benign Het
Med17 A G 9: 15,267,469 Y469H possibly damaging Het
Mindy3 C T 2: 12,405,865 C77Y probably damaging Het
Mmp1a A G 9: 7,467,235 T271A probably benign Het
Ncor2 A T 5: 125,050,956 S118T probably damaging Het
Olfr994 A T 2: 85,430,618 D70E probably damaging Het
Osmr A T 15: 6,852,546 V39D probably damaging Het
Pcdh15 G A 10: 74,631,997 probably benign Het
Pclo A G 5: 14,713,875 K836E probably damaging Het
Pik3r1 A T 13: 101,701,732 L272H probably damaging Het
Pik3r1 G A 13: 101,701,733 L272F probably benign Het
Prrc2b G GCT 2: 32,218,808 probably benign Het
Ptprq T G 10: 107,711,917 I207L probably benign Het
Rasa2 G T 9: 96,560,777 T531K probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a6 G A 9: 108,854,217 probably benign Het
Slc7a13 G A 4: 19,819,492 G231R probably null Het
Slco3a1 T A 7: 74,318,554 N473Y probably damaging Het
Tapt1 G A 5: 44,177,105 L515F probably benign Het
Tmem145 T C 7: 25,308,793 I253T probably benign Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Unc13a A G 8: 71,667,724 probably benign Het
Usp24 T C 4: 106,316,773 V101A probably benign Het
Zfp36l3 T C X: 53,775,873 T125A possibly damaging Het
Other mutations in Gm27013
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4229:Gm27013 UTSW 6 130677345 missense possibly damaging 0.89
R4408:Gm27013 UTSW 6 130677765 missense possibly damaging 0.90
R4585:Gm27013 UTSW 6 130521040 unclassified noncoding transcript
R4586:Gm27013 UTSW 6 130521040 unclassified noncoding transcript
R4823:Gm27013 UTSW 6 130522223 exon noncoding transcript
R4840:Gm27013 UTSW 6 130678116 missense probably benign 0.00
R4842:Gm27013 UTSW 6 130520737 unclassified noncoding transcript
R4943:Gm27013 UTSW 6 130676200 nonsense probably null
R4998:Gm27013 UTSW 6 130676538 missense probably damaging 0.98
R5087:Gm27013 UTSW 6 130677670 missense probably damaging 0.98
R5271:Gm27013 UTSW 6 130676915 missense probably damaging 1.00
R5507:Gm27013 UTSW 6 130675979 missense probably damaging 1.00
R5767:Gm27013 UTSW 6 130675958 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GCGTTCTGTGTAAAAGATTTCCCAC -3'
(R):5'- TCATAGCTGGTATACTGGACCATGG -3'

Sequencing Primer
(F):5'- CCCACATTTGCTACATTTGTAAGG -3'
(R):5'- CTGGTATACTGGACCATGGATAAATG -3'
Posted On2015-06-10