Incidental Mutation 'R4175:D230025D16Rik'
ID318264
Institutional Source Beutler Lab
Gene Symbol D230025D16Rik
Ensembl Gene ENSMUSG00000031889
Gene NameRIKEN cDNA D230025D16 gene
SynonymsLin10
MMRRC Submission 041013-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R4175 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105225145-105253053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105241131 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 218 (L218P)
Ref Sequence ENSEMBL: ENSMUSP00000034361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034361] [ENSMUST00000124113] [ENSMUST00000132964] [ENSMUST00000141957]
Predicted Effect probably benign
Transcript: ENSMUST00000034361
AA Change: L218P

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034361
Gene: ENSMUSG00000031889
AA Change: L218P

DomainStartEndE-ValueType
Pfam:UPF0183 15 407 1.7e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124113
SMART Domains Protein: ENSMUSP00000119743
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 120 1.9e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132964
SMART Domains Protein: ENSMUSP00000123583
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 1 117 1.4e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141957
SMART Domains Protein: ENSMUSP00000119148
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 161 2.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156561
Meta Mutation Damage Score 0.5600 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd63 T C 2: 118,702,619 M274V probably benign Het
Ano6 A T 15: 95,962,169 D724V probably damaging Het
Apobec3 A G 15: 79,895,452 N43S probably damaging Het
Arfgef1 T C 1: 10,159,636 H1280R probably damaging Het
Cbfa2t3 C T 8: 122,643,318 V139M probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Clmp A T 9: 40,771,136 N72I probably benign Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
Creb3l1 A G 2: 91,983,175 F506L probably benign Het
Ctbp1 A G 5: 33,266,906 S47P probably damaging Het
Dus1l G A 11: 120,795,680 R12C possibly damaging Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Epb41l4b A G 4: 57,076,556 V326A probably damaging Het
Fhdc1 T C 3: 84,456,987 probably benign Het
Gm27013 T A 6: 130,677,147 T451S probably benign Het
Ifi208 A T 1: 173,682,701 M141L probably benign Het
Inpp5e A G 2: 26,400,925 S377P probably damaging Het
Kat2a A G 11: 100,705,266 L822P probably damaging Het
Kcnip2 G C 19: 45,812,215 T24S probably benign Het
Med17 A G 9: 15,267,469 Y469H possibly damaging Het
Mindy3 C T 2: 12,405,865 C77Y probably damaging Het
Mmp1a A G 9: 7,467,235 T271A probably benign Het
Ncor2 A T 5: 125,050,956 S118T probably damaging Het
Olfr994 A T 2: 85,430,618 D70E probably damaging Het
Osmr A T 15: 6,852,546 V39D probably damaging Het
Pcdh15 G A 10: 74,631,997 probably benign Het
Pclo A G 5: 14,713,875 K836E probably damaging Het
Pik3r1 A T 13: 101,701,732 L272H probably damaging Het
Pik3r1 G A 13: 101,701,733 L272F probably benign Het
Prrc2b G GCT 2: 32,218,808 probably benign Het
Ptprq T G 10: 107,711,917 I207L probably benign Het
Rasa2 G T 9: 96,560,777 T531K probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a6 G A 9: 108,854,217 probably benign Het
Slc7a13 G A 4: 19,819,492 G231R probably null Het
Slco3a1 T A 7: 74,318,554 N473Y probably damaging Het
Tapt1 G A 5: 44,177,105 L515F probably benign Het
Tmem145 T C 7: 25,308,793 I253T probably benign Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Unc13a A G 8: 71,667,724 probably benign Het
Usp24 T C 4: 106,316,773 V101A probably benign Het
Zfp36l3 T C X: 53,775,873 T125A possibly damaging Het
Other mutations in D230025D16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:D230025D16Rik APN 8 105240001 missense probably damaging 0.99
IGL02058:D230025D16Rik APN 8 105239709 missense probably damaging 1.00
IGL02162:D230025D16Rik APN 8 105239973 splice site probably benign
IGL02264:D230025D16Rik APN 8 105234546 missense possibly damaging 0.67
IGL02512:D230025D16Rik APN 8 105234478 splice site probably benign
FR4340:D230025D16Rik UTSW 8 105241098 missense probably benign
FR4342:D230025D16Rik UTSW 8 105241098 missense probably benign
FR4589:D230025D16Rik UTSW 8 105241098 missense probably benign
R0564:D230025D16Rik UTSW 8 105239971 splice site probably benign
R1458:D230025D16Rik UTSW 8 105246556 critical splice donor site probably null
R1705:D230025D16Rik UTSW 8 105238472 splice site probably benign
R1860:D230025D16Rik UTSW 8 105240071 missense probably null 1.00
R1861:D230025D16Rik UTSW 8 105240071 missense probably null 1.00
R1893:D230025D16Rik UTSW 8 105246501 missense probably damaging 1.00
R1969:D230025D16Rik UTSW 8 105246500 missense possibly damaging 0.81
R2246:D230025D16Rik UTSW 8 105246500 missense possibly damaging 0.81
R3914:D230025D16Rik UTSW 8 105239983 missense probably benign 0.00
R4176:D230025D16Rik UTSW 8 105241131 missense probably benign 0.09
R4602:D230025D16Rik UTSW 8 105246888 missense possibly damaging 0.72
R5965:D230025D16Rik UTSW 8 105234539 missense probably damaging 1.00
R7717:D230025D16Rik UTSW 8 105251604 missense probably benign 0.12
Z1088:D230025D16Rik UTSW 8 105231172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGGAACATGAGCTTTGTAC -3'
(R):5'- TGAAGGTACTAGAAGCTCTGCC -3'

Sequencing Primer
(F):5'- GAACATGAGCTTTGTACTAGGCCC -3'
(R):5'- AAGGTACTAGAAGCTCTGCCTTCTG -3'
Posted On2015-06-10