Incidental Mutation 'R4175:Clmp'
ID318268
Institutional Source Beutler Lab
Gene Symbol Clmp
Ensembl Gene ENSMUSG00000032024
Gene NameCXADR-like membrane protein
Synonyms
MMRRC Submission 041013-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4175 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40685962-40785319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40771136 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 72 (N72I)
Ref Sequence ENSEMBL: ENSMUSP00000034522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034522]
Predicted Effect probably benign
Transcript: ENSMUST00000034522
AA Change: N72I

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034522
Gene: ENSMUSG00000032024
AA Change: N72I

DomainStartEndE-ValueType
IG 19 128 3.46e-7 SMART
IGc2 143 214 1.29e-6 SMART
transmembrane domain 233 255 N/A INTRINSIC
low complexity region 287 313 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134153
Meta Mutation Damage Score 0.0796 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. Expression of this gene in white adipose tissue is implicated in adipocyte maturation and development of obesity. This gene is also essential for normal intestinal development and mutations in the gene are associated with congenital short bowel syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit reduced viability, bilateral hydronephrosis, increased mean systolic blood pressure, and exhibit several blood chemistry and neurological anomalies. Null mice are samller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd63 T C 2: 118,702,619 M274V probably benign Het
Ano6 A T 15: 95,962,169 D724V probably damaging Het
Apobec3 A G 15: 79,895,452 N43S probably damaging Het
Arfgef1 T C 1: 10,159,636 H1280R probably damaging Het
Cbfa2t3 C T 8: 122,643,318 V139M probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
Creb3l1 A G 2: 91,983,175 F506L probably benign Het
Ctbp1 A G 5: 33,266,906 S47P probably damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dus1l G A 11: 120,795,680 R12C possibly damaging Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Epb41l4b A G 4: 57,076,556 V326A probably damaging Het
Fhdc1 T C 3: 84,456,987 probably benign Het
Gm27013 T A 6: 130,677,147 T451S probably benign Het
Ifi208 A T 1: 173,682,701 M141L probably benign Het
Inpp5e A G 2: 26,400,925 S377P probably damaging Het
Kat2a A G 11: 100,705,266 L822P probably damaging Het
Kcnip2 G C 19: 45,812,215 T24S probably benign Het
Med17 A G 9: 15,267,469 Y469H possibly damaging Het
Mindy3 C T 2: 12,405,865 C77Y probably damaging Het
Mmp1a A G 9: 7,467,235 T271A probably benign Het
Ncor2 A T 5: 125,050,956 S118T probably damaging Het
Olfr994 A T 2: 85,430,618 D70E probably damaging Het
Osmr A T 15: 6,852,546 V39D probably damaging Het
Pcdh15 G A 10: 74,631,997 probably benign Het
Pclo A G 5: 14,713,875 K836E probably damaging Het
Pik3r1 A T 13: 101,701,732 L272H probably damaging Het
Pik3r1 G A 13: 101,701,733 L272F probably benign Het
Prrc2b G GCT 2: 32,218,808 probably benign Het
Ptprq T G 10: 107,711,917 I207L probably benign Het
Rasa2 G T 9: 96,560,777 T531K probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a6 G A 9: 108,854,217 probably benign Het
Slc7a13 G A 4: 19,819,492 G231R probably null Het
Slco3a1 T A 7: 74,318,554 N473Y probably damaging Het
Tapt1 G A 5: 44,177,105 L515F probably benign Het
Tmem145 T C 7: 25,308,793 I253T probably benign Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Unc13a A G 8: 71,667,724 probably benign Het
Usp24 T C 4: 106,316,773 V101A probably benign Het
Zfp36l3 T C X: 53,775,873 T125A possibly damaging Het
Other mutations in Clmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Clmp APN 9 40782610 makesense probably null
IGL01783:Clmp APN 9 40782407 missense possibly damaging 0.91
IGL02565:Clmp APN 9 40772415 missense probably damaging 1.00
IGL02953:Clmp APN 9 40774387 missense probably damaging 1.00
IGL02976:Clmp APN 9 40781224 missense possibly damaging 0.92
IGL03357:Clmp APN 9 40686327 utr 5 prime probably benign
IGL03383:Clmp APN 9 40774441 missense probably damaging 1.00
R0530:Clmp UTSW 9 40761006 missense probably benign 0.00
R0539:Clmp UTSW 9 40782486 missense probably benign 0.00
R1453:Clmp UTSW 9 40782441 missense probably damaging 0.98
R1623:Clmp UTSW 9 40782560 missense probably benign
R2899:Clmp UTSW 9 40782392 missense probably damaging 1.00
R5570:Clmp UTSW 9 40772530 critical splice donor site probably null
R6048:Clmp UTSW 9 40771109 missense probably damaging 1.00
R6240:Clmp UTSW 9 40782411 missense probably damaging 1.00
R6551:Clmp UTSW 9 40771277 missense probably benign
R7216:Clmp UTSW 9 40760909 missense possibly damaging 0.62
R8179:Clmp UTSW 9 40781179 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGGACTTTATGAATAAACCCTACGC -3'
(R):5'- GGGGTCCTACTTTACCTAGCAC -3'

Sequencing Primer
(F):5'- AGTTTGAGACTAGCCTGGTCCAC -3'
(R):5'- CTTTCAAGATGACATGGCTCCAG -3'
Posted On2015-06-10