Incidental Mutation 'R4175:Ano6'
ID318282
Institutional Source Beutler Lab
Gene Symbol Ano6
Ensembl Gene ENSMUSG00000064210
Gene Nameanoctamin 6
SynonymsTmem16f, 2900059G15Rik, F730003B03Rik
MMRRC Submission 041013-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R4175 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location95790843-95974751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95962169 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 724 (D724V)
Ref Sequence ENSEMBL: ENSMUSP00000153954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071874] [ENSMUST00000227151] [ENSMUST00000227791]
Predicted Effect probably damaging
Transcript: ENSMUST00000071874
AA Change: D703V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071770
Gene: ENSMUSG00000064210
AA Change: D703V

DomainStartEndE-ValueType
low complexity region 9 27 N/A INTRINSIC
Pfam:Anoct_dimer 63 285 4.5e-70 PFAM
Pfam:Anoctamin 288 872 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227151
Predicted Effect probably damaging
Transcript: ENSMUST00000227791
AA Change: D724V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9714 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass transmembrane protein that belongs to the anoctamin family. This protein is an essential component for the calcium-dependent exposure of phosphatidylserine on the cell surface. The scrambling of phospholipid occurs in various biological systems, such as when blood platelets are activated, they expose phosphatidylserine to trigger the clotting system. Mutations in this gene are associated with Scott syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired platelet coagulation with increased bleeding time. Mice homozygous for a different knock out allele or gene trap exhibit decreased bone mineral deposition and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd63 T C 2: 118,702,619 M274V probably benign Het
Apobec3 A G 15: 79,895,452 N43S probably damaging Het
Arfgef1 T C 1: 10,159,636 H1280R probably damaging Het
Cbfa2t3 C T 8: 122,643,318 V139M probably damaging Het
Cd200r3 T A 16: 44,954,189 D188E probably benign Het
Clmp A T 9: 40,771,136 N72I probably benign Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
Creb3l1 A G 2: 91,983,175 F506L probably benign Het
Ctbp1 A G 5: 33,266,906 S47P probably damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dus1l G A 11: 120,795,680 R12C possibly damaging Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Epb41l4b A G 4: 57,076,556 V326A probably damaging Het
Fhdc1 T C 3: 84,456,987 probably benign Het
Gm27013 T A 6: 130,677,147 T451S probably benign Het
Ifi208 A T 1: 173,682,701 M141L probably benign Het
Inpp5e A G 2: 26,400,925 S377P probably damaging Het
Kat2a A G 11: 100,705,266 L822P probably damaging Het
Kcnip2 G C 19: 45,812,215 T24S probably benign Het
Med17 A G 9: 15,267,469 Y469H possibly damaging Het
Mindy3 C T 2: 12,405,865 C77Y probably damaging Het
Mmp1a A G 9: 7,467,235 T271A probably benign Het
Ncor2 A T 5: 125,050,956 S118T probably damaging Het
Olfr994 A T 2: 85,430,618 D70E probably damaging Het
Osmr A T 15: 6,852,546 V39D probably damaging Het
Pcdh15 G A 10: 74,631,997 probably benign Het
Pclo A G 5: 14,713,875 K836E probably damaging Het
Pik3r1 A T 13: 101,701,732 L272H probably damaging Het
Pik3r1 G A 13: 101,701,733 L272F probably benign Het
Prrc2b G GCT 2: 32,218,808 probably benign Het
Ptprq T G 10: 107,711,917 I207L probably benign Het
Rasa2 G T 9: 96,560,777 T531K probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a6 G A 9: 108,854,217 probably benign Het
Slc7a13 G A 4: 19,819,492 G231R probably null Het
Slco3a1 T A 7: 74,318,554 N473Y probably damaging Het
Tapt1 G A 5: 44,177,105 L515F probably benign Het
Tmem145 T C 7: 25,308,793 I253T probably benign Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Unc13a A G 8: 71,667,724 probably benign Het
Usp24 T C 4: 106,316,773 V101A probably benign Het
Zfp36l3 T C X: 53,775,873 T125A possibly damaging Het
Other mutations in Ano6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ano6 APN 15 95948429 missense probably damaging 1.00
IGL01308:Ano6 APN 15 95913661 splice site probably null
IGL01490:Ano6 APN 15 95948410 missense probably benign 0.08
IGL01663:Ano6 APN 15 95967614 splice site probably null
IGL01783:Ano6 APN 15 95962262 missense possibly damaging 0.94
IGL02040:Ano6 APN 15 95955944 missense probably benign 0.00
IGL02114:Ano6 APN 15 95943460 missense probably damaging 0.96
IGL02683:Ano6 APN 15 95948312 missense probably damaging 1.00
IGL03297:Ano6 APN 15 95962277 missense probably damaging 1.00
IGL03401:Ano6 APN 15 95949905 missense probably damaging 1.00
R0730:Ano6 UTSW 15 95920371 missense probably damaging 1.00
R1086:Ano6 UTSW 15 95949962 splice site probably null
R1264:Ano6 UTSW 15 95949566 missense probably damaging 1.00
R1421:Ano6 UTSW 15 95913385 missense probably benign 0.13
R1494:Ano6 UTSW 15 95972507 missense probably damaging 0.98
R1755:Ano6 UTSW 15 95972570 missense possibly damaging 0.74
R1757:Ano6 UTSW 15 95962267 missense probably damaging 1.00
R2042:Ano6 UTSW 15 95956023 critical splice donor site probably null
R2393:Ano6 UTSW 15 95966025 critical splice donor site probably benign
R2415:Ano6 UTSW 15 95962280 missense probably damaging 1.00
R2483:Ano6 UTSW 15 95965974 missense probably benign 0.00
R2879:Ano6 UTSW 15 95943427 nonsense probably null
R3440:Ano6 UTSW 15 95967721 missense probably damaging 1.00
R3716:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3717:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3718:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R3887:Ano6 UTSW 15 95894449 missense possibly damaging 0.64
R4214:Ano6 UTSW 15 95965909 missense probably benign
R4591:Ano6 UTSW 15 95943427 nonsense probably null
R5249:Ano6 UTSW 15 95913588 missense probably benign 0.35
R5383:Ano6 UTSW 15 95916037 missense probably benign 0.00
R5496:Ano6 UTSW 15 95967614 splice site probably null
R5532:Ano6 UTSW 15 95962241 missense probably damaging 1.00
R5598:Ano6 UTSW 15 95941347 missense probably damaging 1.00
R5645:Ano6 UTSW 15 95920351 missense probably benign 0.03
R5739:Ano6 UTSW 15 95913379 missense probably damaging 1.00
R5794:Ano6 UTSW 15 95894524 missense probably benign 0.00
R5864:Ano6 UTSW 15 95920380 critical splice donor site probably null
R5936:Ano6 UTSW 15 95972601 missense probably damaging 1.00
R5937:Ano6 UTSW 15 95913957 missense probably damaging 0.98
R6063:Ano6 UTSW 15 95948417 missense probably damaging 1.00
R6191:Ano6 UTSW 15 95948499 critical splice donor site probably null
R6275:Ano6 UTSW 15 95913433 missense probably damaging 1.00
R6349:Ano6 UTSW 15 95966022 missense probably damaging 0.97
R6468:Ano6 UTSW 15 95967714 missense probably benign 0.01
R6734:Ano6 UTSW 15 95949536 missense probably damaging 0.99
R6830:Ano6 UTSW 15 95894461 missense probably damaging 1.00
R6883:Ano6 UTSW 15 95962111 missense probably damaging 1.00
R6892:Ano6 UTSW 15 95967624 missense probably damaging 1.00
R7171:Ano6 UTSW 15 95920291 missense probably damaging 1.00
R7271:Ano6 UTSW 15 95913900 missense probably damaging 1.00
R7284:Ano6 UTSW 15 95948303 missense probably damaging 1.00
R7326:Ano6 UTSW 15 95864244 missense possibly damaging 0.95
R7937:Ano6 UTSW 15 95972589 missense probably damaging 1.00
R7944:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7945:Ano6 UTSW 15 95941309 missense probably damaging 1.00
R7954:Ano6 UTSW 15 95965821 missense possibly damaging 0.93
R8496:Ano6 UTSW 15 95949926 missense probably damaging 1.00
X0066:Ano6 UTSW 15 95943434 missense probably damaging 0.99
Z1176:Ano6 UTSW 15 95913460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGTGGGAGATGAGCTGTC -3'
(R):5'- TGTAGCAGAAGACAGTTGCATAAC -3'

Sequencing Primer
(F):5'- AGATGAGCTGTCTTTAGTCACC -3'
(R):5'- GGAGAAGAACACTTGCTGCTCTTAC -3'
Posted On2015-06-10