Incidental Mutation 'R4191:Lrrfip1'
ID318287
Institutional Source Beutler Lab
Gene Symbol Lrrfip1
Ensembl Gene ENSMUSG00000026305
Gene Nameleucine rich repeat (in FLII) interacting protein 1
SynonymsFliiap1, FLAP (FLI LRR associated protein)
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location90998737-91128944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91110399 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 446 (E446D)
Ref Sequence ENSEMBL: ENSMUSP00000139811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068116] [ENSMUST00000068167] [ENSMUST00000097649] [ENSMUST00000097650] [ENSMUST00000185531] [ENSMUST00000189505] [ENSMUST00000189617]
Predicted Effect probably benign
Transcript: ENSMUST00000068116
SMART Domains Protein: ENSMUSP00000065850
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 33 354 4.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068167
AA Change: E411D

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000063878
Gene: ENSMUSG00000026305
AA Change: E411D

DomainStartEndE-ValueType
Pfam:DUF2051 23 123 2.2e-18 PFAM
Pfam:DUF2051 193 387 2.5e-49 PFAM
Pfam:DUF2051 366 553 8.1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097649
SMART Domains Protein: ENSMUSP00000095254
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 23 327 1.3e-87 PFAM
internal_repeat_2 439 528 6e-5 PROSPERO
low complexity region 550 566 N/A INTRINSIC
internal_repeat_2 575 683 6e-5 PROSPERO
internal_repeat_1 647 715 1.05e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000097650
AA Change: E411D

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095255
Gene: ENSMUSG00000026305
AA Change: E411D

DomainStartEndE-ValueType
Pfam:DUF2051 23 120 2.3e-16 PFAM
Pfam:DUF2051 195 368 1.2e-63 PFAM
Pfam:DUF2051 379 554 1.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185531
AA Change: E456D

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139497
Gene: ENSMUSG00000026305
AA Change: E456D

DomainStartEndE-ValueType
Pfam:DUF2051 33 118 1.2e-12 PFAM
low complexity region 138 158 N/A INTRINSIC
Pfam:DUF2051 231 413 3.7e-60 PFAM
Pfam:DUF2051 424 575 1.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188708
Predicted Effect probably benign
Transcript: ENSMUST00000189505
SMART Domains Protein: ENSMUSP00000141024
Gene: ENSMUSG00000026305

DomainStartEndE-ValueType
Pfam:DUF2051 33 306 7.2e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189617
AA Change: E446D

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139811
Gene: ENSMUSG00000026305
AA Change: E446D

DomainStartEndE-ValueType
Pfam:DUF2051 23 108 1.4e-12 PFAM
low complexity region 128 148 N/A INTRINSIC
Pfam:DUF2051 229 403 1.2e-60 PFAM
Pfam:DUF2051 414 589 1.8e-44 PFAM
Meta Mutation Damage Score 0.1760 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Lrrfip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Lrrfip1 APN 1 91068621 missense probably damaging 1.00
IGL00835:Lrrfip1 APN 1 91115418 missense possibly damaging 0.89
IGL01603:Lrrfip1 APN 1 91115913 missense probably benign 0.03
IGL02261:Lrrfip1 APN 1 91112168 missense probably benign 0.22
IGL02401:Lrrfip1 APN 1 91114928 missense probably benign 0.21
IGL02690:Lrrfip1 APN 1 91053661 missense probably damaging 0.97
R0048:Lrrfip1 UTSW 1 91093647 splice site probably benign
R0048:Lrrfip1 UTSW 1 91093647 splice site probably benign
R0891:Lrrfip1 UTSW 1 91068615 missense probably damaging 1.00
R1210:Lrrfip1 UTSW 1 91115193 missense probably benign 0.16
R1352:Lrrfip1 UTSW 1 91115367 missense probably benign
R1488:Lrrfip1 UTSW 1 91114632 missense probably damaging 1.00
R1600:Lrrfip1 UTSW 1 91114667 missense probably damaging 0.98
R1718:Lrrfip1 UTSW 1 91115555 missense probably damaging 0.99
R2056:Lrrfip1 UTSW 1 91115817 missense probably benign 0.25
R2993:Lrrfip1 UTSW 1 91105234 missense probably damaging 0.99
R3782:Lrrfip1 UTSW 1 91112189 missense possibly damaging 0.82
R4675:Lrrfip1 UTSW 1 91103320 critical splice donor site probably null
R4732:Lrrfip1 UTSW 1 91115647 missense probably benign 0.29
R4733:Lrrfip1 UTSW 1 91115647 missense probably benign 0.29
R5196:Lrrfip1 UTSW 1 91114608 missense probably damaging 1.00
R5250:Lrrfip1 UTSW 1 91115896 missense possibly damaging 0.90
R5433:Lrrfip1 UTSW 1 91087126 critical splice donor site probably null
R6005:Lrrfip1 UTSW 1 91114611 missense probably damaging 1.00
R6218:Lrrfip1 UTSW 1 91082159 missense probably damaging 0.96
R6600:Lrrfip1 UTSW 1 91115847 missense probably damaging 0.99
R6847:Lrrfip1 UTSW 1 91105128 missense probably damaging 1.00
R6911:Lrrfip1 UTSW 1 91114807 nonsense probably null
R6940:Lrrfip1 UTSW 1 91122413 splice site probably null
R6976:Lrrfip1 UTSW 1 91115015 missense probably benign 0.00
R7002:Lrrfip1 UTSW 1 91115458 missense probably benign 0.31
R7205:Lrrfip1 UTSW 1 91091616 missense probably benign 0.00
R7363:Lrrfip1 UTSW 1 91123120 missense probably benign 0.05
R7552:Lrrfip1 UTSW 1 91105283 missense probably damaging 1.00
X0057:Lrrfip1 UTSW 1 91115403 missense possibly damaging 0.67
Z1088:Lrrfip1 UTSW 1 91115530 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCTCATTGGTGCCCTGGATG -3'
(R):5'- CTGGCAGAAGCACATATGGG -3'

Sequencing Primer
(F):5'- TGGATGACAGTGCCTCCTAGAC -3'
(R):5'- TGGCACACCTACTTCCTAGGGATAG -3'
Posted On2015-06-10