Incidental Mutation 'R4191:Trove2'
List |< first << previous [record 46 of 51] next >> last >|
ID318288
Institutional Source Beutler Lab
Gene Symbol Trove2
Ensembl Gene ENSMUSG00000018199
Gene NameTROVE domain family, member 2
Synonyms1810007I17Rik, A530054J02Rik, SS-A/Ro, Ssa, Ssa2
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location143750790-143777068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143770786 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 74 (I74V)
Ref Sequence ENSEMBL: ENSMUSP00000125623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159879]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000018343
Predicted Effect probably benign
Transcript: ENSMUST00000159879
AA Change: I74V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125623
Gene: ENSMUSG00000018199
AA Change: I74V

DomainStartEndE-ValueType
Pfam:TROVE 16 369 9.7e-99 PFAM
Meta Mutation Damage Score 0.0720 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype PHENOTYPE: Homozygous mutant mice develop symptoms similar to those observed in patients with lupus, including increased photosensitivity and membranoproliferative glomerulonephritis. The production of autoantibodies is detected in both homozygous and heterozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Trove2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Trove2 APN 1 143761382 missense probably benign 0.29
IGL01578:Trove2 APN 1 143761300 missense probably damaging 0.99
IGL02006:Trove2 APN 1 143760346 splice site probably benign
IGL02155:Trove2 APN 1 143761269 critical splice donor site probably null
IGL02219:Trove2 APN 1 143761275 missense possibly damaging 0.94
IGL02637:Trove2 APN 1 143770788 missense probably damaging 1.00
IGL03013:Trove2 APN 1 143770708 missense probably damaging 1.00
IGL03075:Trove2 APN 1 143770771 missense probably benign
R0415:Trove2 UTSW 1 143760075 missense probably benign 0.00
R0443:Trove2 UTSW 1 143765923 splice site probably benign
R0479:Trove2 UTSW 1 143757751 missense possibly damaging 0.72
R1696:Trove2 UTSW 1 143757837 missense probably damaging 0.99
R1728:Trove2 UTSW 1 143760014 missense probably benign
R1728:Trove2 UTSW 1 143760034 missense probably benign
R1729:Trove2 UTSW 1 143760014 missense probably benign
R1729:Trove2 UTSW 1 143760034 missense probably benign
R1730:Trove2 UTSW 1 143760014 missense probably benign
R1730:Trove2 UTSW 1 143760034 missense probably benign
R1739:Trove2 UTSW 1 143760014 missense probably benign
R1739:Trove2 UTSW 1 143760034 missense probably benign
R1762:Trove2 UTSW 1 143760014 missense probably benign
R1762:Trove2 UTSW 1 143760034 missense probably benign
R1783:Trove2 UTSW 1 143760014 missense probably benign
R1783:Trove2 UTSW 1 143760034 missense probably benign
R1784:Trove2 UTSW 1 143760014 missense probably benign
R1784:Trove2 UTSW 1 143760034 missense probably benign
R1785:Trove2 UTSW 1 143760014 missense probably benign
R1785:Trove2 UTSW 1 143760034 missense probably benign
R1857:Trove2 UTSW 1 143770750 missense probably benign 0.00
R2049:Trove2 UTSW 1 143760034 missense probably benign
R2130:Trove2 UTSW 1 143760034 missense probably benign
R2131:Trove2 UTSW 1 143760034 missense probably benign
R2133:Trove2 UTSW 1 143760034 missense probably benign
R2141:Trove2 UTSW 1 143760034 missense probably benign
R2142:Trove2 UTSW 1 143760034 missense probably benign
R2372:Trove2 UTSW 1 143770882 nonsense probably null
R2929:Trove2 UTSW 1 143757878 missense possibly damaging 0.92
R5520:Trove2 UTSW 1 143770771 missense probably benign
R5821:Trove2 UTSW 1 143766765 missense probably benign 0.09
R7432:Trove2 UTSW 1 143765810 missense probably benign 0.43
R7658:Trove2 UTSW 1 143770873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGCCACACTTCATGCTC -3'
(R):5'- TTGCAGCCACTGAGTGAGAC -3'

Sequencing Primer
(F):5'- CCTTCAGGTCTTTCTTAAACTGG -3'
(R):5'- CTCAAGTAGTTAACTCAGAGGGC -3'
Posted On2015-06-10