Incidental Mutation 'R4191:Disp1'
ID318289
Institutional Source Beutler Lab
Gene Symbol Disp1
Ensembl Gene ENSMUSG00000030768
Gene Namedispatched RND transporter family member 1
Synonyms1190008H24Rik, DispA
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location183086266-183221522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 183089173 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 561 (A561E)
Ref Sequence ENSEMBL: ENSMUSP00000141747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]
Predicted Effect probably damaging
Transcript: ENSMUST00000003035
AA Change: A561E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: A561E

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 279 765 6.8e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 518 670 1.7e-15 PFAM
Pfam:Patched 916 1130 8e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171366
AA Change: A561E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: A561E

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195372
AA Change: A561E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: A561E

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Disp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1120:Disp1 UTSW 1 183098575 missense probably benign 0.24
R1482:Disp1 UTSW 1 183086474 missense possibly damaging 0.61
R1655:Disp1 UTSW 1 183087004 missense probably benign 0.01
R1660:Disp1 UTSW 1 183087742 missense probably damaging 1.00
R1816:Disp1 UTSW 1 183098575 missense probably damaging 0.99
R1835:Disp1 UTSW 1 183089000 missense probably damaging 1.00
R1954:Disp1 UTSW 1 183088543 missense probably damaging 0.99
R2025:Disp1 UTSW 1 183088203 missense probably damaging 1.00
R2136:Disp1 UTSW 1 183088378 missense probably damaging 1.00
R2150:Disp1 UTSW 1 183088372 missense probably damaging 1.00
R2207:Disp1 UTSW 1 183088342 missense possibly damaging 0.94
R2392:Disp1 UTSW 1 183087167 missense probably benign
R2831:Disp1 UTSW 1 183089319 small deletion probably benign
R3111:Disp1 UTSW 1 183087523 missense probably damaging 1.00
R3116:Disp1 UTSW 1 183088922 missense probably benign 0.01
R3160:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3161:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3162:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3162:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3716:Disp1 UTSW 1 183087751 missense probably damaging 1.00
R3914:Disp1 UTSW 1 183089102 missense probably benign 0.05
R4061:Disp1 UTSW 1 183087700 missense probably damaging 0.96
R4261:Disp1 UTSW 1 183089386 missense probably damaging 1.00
R4272:Disp1 UTSW 1 183087644 missense possibly damaging 0.95
R4273:Disp1 UTSW 1 183087644 missense possibly damaging 0.95
R4351:Disp1 UTSW 1 183099978 missense probably benign 0.01
R4672:Disp1 UTSW 1 183098651 critical splice acceptor site probably null
R4764:Disp1 UTSW 1 183088096 missense probably damaging 1.00
R4910:Disp1 UTSW 1 183135463 missense probably damaging 1.00
R5150:Disp1 UTSW 1 183089499 missense probably damaging 0.98
R5502:Disp1 UTSW 1 183087886 missense probably damaging 1.00
R5616:Disp1 UTSW 1 183088349 missense probably benign 0.30
R5699:Disp1 UTSW 1 183088555 nonsense probably null
R5813:Disp1 UTSW 1 183088410 missense probably damaging 1.00
R5820:Disp1 UTSW 1 183135587 missense probably benign 0.00
R6184:Disp1 UTSW 1 183086332 missense probably benign 0.00
R6228:Disp1 UTSW 1 183099025 missense possibly damaging 0.59
R6306:Disp1 UTSW 1 183087148 missense possibly damaging 0.93
R6505:Disp1 UTSW 1 183086512 missense probably benign 0.02
R6925:Disp1 UTSW 1 183086478 missense probably benign
R7016:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7045:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7046:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7047:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7114:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7123:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7124:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7125:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7161:Disp1 UTSW 1 183087625 missense possibly damaging 0.84
R7510:Disp1 UTSW 1 183088411 missense probably damaging 1.00
R7756:Disp1 UTSW 1 183089734 missense probably damaging 1.00
R7800:Disp1 UTSW 1 183098986 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTGATGGCCGTGATGTTG -3'
(R):5'- TTACCTCCTCATGGACACCGTG -3'

Sequencing Primer
(F):5'- CGTAGTTAGCGTAGAAGGCAGC -3'
(R):5'- TCATGGACACCGTGTACCC -3'
Posted On2015-06-10