Incidental Mutation 'R4191:Olfr1049'
ID318294
Institutional Source Beutler Lab
Gene Symbol Olfr1049
Ensembl Gene ENSMUSG00000075194
Gene Nameolfactory receptor 1049
SynonymsGA_x6K02T2Q125-47735396-47734470, MOR187-1
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86254357-86258328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86255322 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 124 (V124L)
Ref Sequence ENSEMBL: ENSMUSP00000149360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099899] [ENSMUST00000216185]
Predicted Effect probably benign
Transcript: ENSMUST00000099899
AA Change: V124L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097483
Gene: ENSMUSG00000075194
AA Change: V124L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.9e-54 PFAM
Pfam:7tm_1 41 290 5.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216185
AA Change: V124L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.1175 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Olfr1049
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01659:Olfr1049 APN 2 86255185 nonsense probably null
IGL03371:Olfr1049 APN 2 86255591 missense possibly damaging 0.88
IGL03378:Olfr1049 APN 2 86255019 missense possibly damaging 0.91
R1529:Olfr1049 UTSW 2 86255241 missense probably damaging 1.00
R1761:Olfr1049 UTSW 2 86255039 missense probably damaging 1.00
R1951:Olfr1049 UTSW 2 86255096 missense probably benign 0.01
R3499:Olfr1049 UTSW 2 86254841 missense possibly damaging 0.91
R3974:Olfr1049 UTSW 2 86255591 missense possibly damaging 0.88
R4094:Olfr1049 UTSW 2 86255330 missense probably damaging 1.00
R4659:Olfr1049 UTSW 2 86255013 nonsense probably null
R6431:Olfr1049 UTSW 2 86255358 missense probably benign 0.01
R7006:Olfr1049 UTSW 2 86255228 missense probably benign 0.01
R7090:Olfr1049 UTSW 2 86255076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCTTCTACATGTGAACAGATC -3'
(R):5'- TGGACTCTCGCCTACAAACC -3'

Sequencing Primer
(F):5'- CTTCTACATGTGAACAGATCAAAGG -3'
(R):5'- ATCAGACACCTTGCTTTCATTG -3'
Posted On2015-06-10