Incidental Mutation 'R4191:Pex10'
ID318305
Institutional Source Beutler Lab
Gene Symbol Pex10
Ensembl Gene ENSMUSG00000029047
Gene Nameperoxisomal biogenesis factor 10
Synonymsperoxisome biogenesis factor 10, LOC230983
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location155067016-155072433 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 155067905 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103180]
Predicted Effect probably null
Transcript: ENSMUST00000103180
SMART Domains Protein: ENSMUSP00000099469
Gene: ENSMUSG00000029047

DomainStartEndE-ValueType
Pfam:Pex2_Pex12 16 241 2.3e-43 PFAM
low complexity region 248 260 N/A INTRINSIC
RING 271 308 4.48e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134341
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in import of peroxisomal matrix proteins. This protein localizes to the peroxisomal membrane. Mutations in this gene result in phenotypes within the Zellweger spectrum of peroxisomal biogenesis disorders, ranging from neonatal adrenoleukodystrophy to Zellweger syndrome. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit partial neonatal mortality due to respiratory distress, loss of embryonic movement, and prenatal pathology including altered biochemistry, defects in axonal integrity, decreased Schwann cell number, and defects at the neuromuscular junction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Pex10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02487:Pex10 APN 4 155070733 missense probably damaging 1.00
IGL03179:Pex10 APN 4 155067897 missense probably benign
IGL03014:Pex10 UTSW 4 155070619 intron probably benign
R0088:Pex10 UTSW 4 155070498 missense probably damaging 0.98
R0445:Pex10 UTSW 4 155069074 splice site probably null
R4544:Pex10 UTSW 4 155070495 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACTTGGACTTTACCTGCCC -3'
(R):5'- AAAGCCCATCCTGCTGAGAG -3'

Sequencing Primer
(F):5'- GGTCAGTCTGGACTCGAAATCTC -3'
(R):5'- CCATCCTGCTGAGAGAAAGTCTG -3'
Posted On2015-06-10