Incidental Mutation 'R4191:Ache'
ID318306
Institutional Source Beutler Lab
Gene Symbol Ache
Ensembl Gene ENSMUSG00000023328
Gene Nameacetylcholinesterase
Synonyms
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137287519-137294466 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 137291072 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 347 (I347F)
Ref Sequence ENSEMBL: ENSMUSP00000083097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024099] [ENSMUST00000040873] [ENSMUST00000052825] [ENSMUST00000085934] [ENSMUST00000125195] [ENSMUST00000132191] [ENSMUST00000137126] [ENSMUST00000138591] [ENSMUST00000141123] [ENSMUST00000196109] [ENSMUST00000196208] [ENSMUST00000197466] [ENSMUST00000198526] [ENSMUST00000199243]
Predicted Effect probably damaging
Transcript: ENSMUST00000024099
AA Change: I347F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024099
Gene: ENSMUSG00000023328
AA Change: I347F

DomainStartEndE-ValueType
Pfam:COesterase 14 563 2e-186 PFAM
Pfam:Abhydrolase_3 146 276 7.5e-9 PFAM
Pfam:AChE_tetra 578 614 3.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040873
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052825
SMART Domains Protein: ENSMUSP00000056156
Gene: ENSMUSG00000051502

DomainStartEndE-ValueType
Pfam:Peptidase_C78 27 212 5.4e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085934
AA Change: I347F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083097
Gene: ENSMUSG00000023328
AA Change: I347F

DomainStartEndE-ValueType
Pfam:COesterase 15 563 3e-178 PFAM
Pfam:Abhydrolase_3 146 260 1.4e-7 PFAM
Pfam:AChE_tetra 578 613 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125195
Predicted Effect probably benign
Transcript: ENSMUST00000132191
Predicted Effect probably benign
Transcript: ENSMUST00000137126
Predicted Effect probably benign
Transcript: ENSMUST00000138591
Predicted Effect probably benign
Transcript: ENSMUST00000141123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184134
Predicted Effect probably benign
Transcript: ENSMUST00000196109
SMART Domains Protein: ENSMUSP00000142351
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
Blast:RRM 65 133 2e-15 BLAST
low complexity region 208 237 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Pfam:ARS2 277 498 6.5e-111 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196208
AA Change: I347F

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142427
Gene: ENSMUSG00000023328
AA Change: I347F

DomainStartEndE-ValueType
Pfam:COesterase 14 359 6.5e-134 PFAM
Pfam:Abhydrolase_3 146 284 4.1e-7 PFAM
Pfam:COesterase 355 475 1.5e-25 PFAM
Pfam:AChE_tetra 490 526 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196960
Predicted Effect probably benign
Transcript: ENSMUST00000197466
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198526
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199243
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199756
Meta Mutation Damage Score 0.5641 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetylcholinesterase hydrolyzes the neurotransmitter, acetylcholine at neuromuscular junctions and brain cholinergic synapses, and thus terminates signal transmission. It is also found on the red blood cell membranes, where it constitutes the Yt blood group antigen. Acetylcholinesterase exists in multiple molecular forms which possess similar catalytic properties, but differ in their oligomeric assembly and mode of cell attachment to the cell surface. It is encoded by the single ACHE gene, and the structural diversity in the gene products arises from alternative mRNA splicing, and post-translational associations of catalytic and structural subunits. The major form of acetylcholinesterase found in brain, muscle and other tissues is the hydrophilic species, which forms disulfide-linked oligomers with collagenous, or lipid-containing structural subunits. The other, alternatively spliced form, expressed primarily in the erythroid tissues, differs at the C-terminal end, and contains a cleavable hydrophobic peptide with a GPI-anchor site. It associates with the membranes through the phosphoinositide (PI) moieties added post-translationally. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show retarded postnatal development, tremors, impaired righting response, delayed maturation of external ear, failure of eyelids to open, and die by 3-wk. of age. Mutants are highly sensitive to butyrylcholinesterase inhibitor toxicity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Ache
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02323:Ache APN 5 137291064 missense probably damaging 1.00
IGL02833:Ache APN 5 137291109 unclassified probably benign
R0058:Ache UTSW 5 137290842 missense probably damaging 1.00
R0358:Ache UTSW 5 137290373 missense probably benign 0.21
R0377:Ache UTSW 5 137290928 missense possibly damaging 0.54
R0780:Ache UTSW 5 137290532 missense probably damaging 1.00
R1233:Ache UTSW 5 137290157 unclassified probably null
R1702:Ache UTSW 5 137290989 missense possibly damaging 0.94
R1762:Ache UTSW 5 137290575 missense possibly damaging 0.91
R4226:Ache UTSW 5 137290890 missense possibly damaging 0.83
R4499:Ache UTSW 5 137291932 missense probably damaging 0.98
R4931:Ache UTSW 5 137291914 missense probably benign 0.00
R5411:Ache UTSW 5 137290064 missense possibly damaging 0.93
R5411:Ache UTSW 5 137290430 unclassified probably null
R5698:Ache UTSW 5 137290559 missense probably damaging 1.00
R6153:Ache UTSW 5 137291855 missense probably damaging 1.00
R6526:Ache UTSW 5 137290644 missense probably damaging 1.00
R6896:Ache UTSW 5 137291734 missense probably damaging 0.98
R6981:Ache UTSW 5 137291678 missense probably benign
R7199:Ache UTSW 5 137290242 missense probably damaging 1.00
R7208:Ache UTSW 5 137291489 missense probably damaging 1.00
X0061:Ache UTSW 5 137290095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCACATACTGTCCCTGCC -3'
(R):5'- GGAAGGACTGATTTTGGGACCC -3'

Sequencing Primer
(F):5'- AGCAGGAGCCTCTTCCACAG -3'
(R):5'- TTTGGGACCCACAAACTTGG -3'
Posted On2015-06-10