Incidental Mutation 'R4191:Klrb1'
List |< first << previous [record 17 of 51] next >> last >|
ID318308
Institutional Source Beutler Lab
Gene Symbol Klrb1
Ensembl Gene ENSMUSG00000079299
Gene Namekiller cell lectin-like receptor subfamily B member 1
SynonymsGm4696, 4930431A04Rik, Nkrp1g, Ly-55, Ly55
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128705836-128723059 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 128713634 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 42 (K42*)
Ref Sequence ENSEMBL: ENSMUSP00000107738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112110]
Predicted Effect probably null
Transcript: ENSMUST00000112110
AA Change: K42*
SMART Domains Protein: ENSMUSP00000107738
Gene: ENSMUSG00000079299
AA Change: K42*

DomainStartEndE-ValueType
transmembrane domain 39 61 N/A INTRINSIC
CLECT 91 208 8.55e-19 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype PHENOTYPE: This locus encodes a NK cell specific antigen. Four RFLP patterns differing among inbred strains have been identified in reference J:12581. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Klrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Klrb1 APN 6 128723005 missense probably benign 0.01
IGL01880:Klrb1 APN 6 128712319 missense possibly damaging 0.91
IGL02064:Klrb1 APN 6 128710637 missense probably benign 0.01
IGL02708:Klrb1 APN 6 128713585 missense probably benign 0.12
R0402:Klrb1 UTSW 6 128710620 missense probably benign 0.06
R0842:Klrb1 UTSW 6 128710045 critical splice donor site probably null
R1954:Klrb1 UTSW 6 128723073 unclassified probably null
R2267:Klrb1 UTSW 6 128722974 missense probably damaging 1.00
R5518:Klrb1 UTSW 6 128706525 missense probably benign 0.34
R5524:Klrb1 UTSW 6 128712333 critical splice acceptor site probably null
R6967:Klrb1 UTSW 6 128710523 critical splice donor site probably null
R7519:Klrb1 UTSW 6 128712289 missense probably damaging 1.00
R7670:Klrb1 UTSW 6 128710087 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGACATACCCCATAATGCTACTC -3'
(R):5'- TCTCCAGTATGAGTCAGTCTACTATC -3'

Sequencing Primer
(F):5'- TTCTTCAGAGGGCACAGGATATTGAC -3'
(R):5'- TCTTGTTCAAAATAGTCCTCATAGC -3'
Posted On2015-06-10