Incidental Mutation 'R4191:Cdh11'
ID318313
Institutional Source Beutler Lab
Gene Symbol Cdh11
Ensembl Gene ENSMUSG00000031673
Gene Namecadherin 11
Synonymsosteoblast-cadherin, Cad11, OB-cadherin
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location102632095-102785642 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102650748 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 422 (D422G)
Ref Sequence ENSEMBL: ENSMUSP00000074681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075190]
PDB Structure
Crystal structure of mouse cadherin-11 EC1 [X-RAY DIFFRACTION]
Crystal structure of mouse cadherin-11 EC1-2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000075190
AA Change: D422G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074681
Gene: ENSMUSG00000031673
AA Change: D422G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 76 157 1.99e-19 SMART
CA 181 266 3.33e-30 SMART
CA 290 382 3.37e-17 SMART
CA 405 486 1.14e-23 SMART
CA 513 600 4.77e-8 SMART
transmembrane domain 618 640 N/A INTRINSIC
Pfam:Cadherin_C 643 788 1.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210301
Meta Mutation Damage Score 0.1612 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: This gene encodes a type II classical cadherin and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is an integral membrane protein that mediates calcium-dependent cell-cell adhesion, specifically in the context of bone development. Homozygous knockout mice for this gene exhibit impaired synovium development and reduced bone density. Multiple pseudogenes of this gene have been identified in the genome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous mutant animals appear healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Pmfbp1 A T 8: 109,527,628 M432L probably benign Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Cdh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Cdh11 APN 8 102650649 missense probably damaging 1.00
IGL01019:Cdh11 APN 8 102679745 missense probably benign
IGL01286:Cdh11 APN 8 102664629 missense probably damaging 0.98
IGL01556:Cdh11 APN 8 102679644 missense probably damaging 1.00
IGL01964:Cdh11 APN 8 102664743 missense probably benign 0.03
IGL02322:Cdh11 APN 8 102647519 missense probably benign 0.01
IGL03094:Cdh11 APN 8 102658403 missense probably benign
IGL03110:Cdh11 APN 8 102673870 missense probably damaging 1.00
IGL03391:Cdh11 APN 8 102674023 missense possibly damaging 0.89
R0401:Cdh11 UTSW 8 102674006 missense probably damaging 1.00
R0466:Cdh11 UTSW 8 102670058 missense possibly damaging 0.89
R0731:Cdh11 UTSW 8 102668019 missense probably damaging 1.00
R0925:Cdh11 UTSW 8 102634724 missense probably damaging 1.00
R1597:Cdh11 UTSW 8 102650711 missense probably benign 0.06
R1624:Cdh11 UTSW 8 102664601 splice site probably benign
R1829:Cdh11 UTSW 8 102634641 missense possibly damaging 0.92
R2029:Cdh11 UTSW 8 102679772 missense probably benign 0.00
R4270:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4271:Cdh11 UTSW 8 102664626 missense possibly damaging 0.69
R4455:Cdh11 UTSW 8 102647823 missense probably benign
R4516:Cdh11 UTSW 8 102673962 missense possibly damaging 0.59
R4900:Cdh11 UTSW 8 102647458 splice site probably null
R5441:Cdh11 UTSW 8 102647546 missense probably benign 0.11
R5699:Cdh11 UTSW 8 102634543 missense probably damaging 0.96
R6170:Cdh11 UTSW 8 102634810 missense probably benign 0.00
R6846:Cdh11 UTSW 8 102664644 missense probably damaging 0.97
R7018:Cdh11 UTSW 8 102634321 missense possibly damaging 0.82
R7095:Cdh11 UTSW 8 102658267 missense probably damaging 1.00
R7497:Cdh11 UTSW 8 102673824 missense probably benign 0.00
R7632:Cdh11 UTSW 8 102673883 missense probably damaging 0.99
R7715:Cdh11 UTSW 8 102664714 missense possibly damaging 0.66
R8321:Cdh11 UTSW 8 102634784 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAATCGCAATTCTCAGCAATTTC -3'
(R):5'- TTGTATTGCATAAAGAAGGCCAACAG -3'

Sequencing Primer
(F):5'- TTGAGCCAGGCAGTTTCT -3'
(R):5'- GGCCAACAGACCAAAATGATTTC -3'
Posted On2015-06-10