Incidental Mutation 'R4191:Pmfbp1'
ID318314
Institutional Source Beutler Lab
Gene Symbol Pmfbp1
Ensembl Gene ENSMUSG00000031727
Gene Namepolyamine modulated factor 1 binding protein 1
SynonymsF77, 1700016D22Rik
MMRRC Submission 041022-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R4191 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109494027-109542640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109527628 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 432 (M432L)
Ref Sequence ENSEMBL: ENSMUSP00000034162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034162]
Predicted Effect probably benign
Transcript: ENSMUST00000034162
AA Change: M432L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034162
Gene: ENSMUSG00000031727
AA Change: M432L

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
internal_repeat_1 38 84 9.43e-6 PROSPERO
coiled coil region 89 121 N/A INTRINSIC
internal_repeat_1 138 178 9.43e-6 PROSPERO
coiled coil region 197 223 N/A INTRINSIC
coiled coil region 334 377 N/A INTRINSIC
low complexity region 392 403 N/A INTRINSIC
coiled coil region 411 732 N/A INTRINSIC
coiled coil region 758 879 N/A INTRINSIC
coiled coil region 931 968 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212003
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik C T 17: 47,436,637 R61H probably damaging Het
Abcc1 A G 16: 14,389,864 T22A probably damaging Het
Ache A T 5: 137,291,072 I347F probably damaging Het
Adgrl1 C G 8: 83,938,940 R1464G probably benign Het
Cdh11 T C 8: 102,650,748 D422G probably damaging Het
Cdx1 C T 18: 61,020,438 S176N possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Cyct G T 2: 76,354,191 P72Q probably damaging Het
Ddx19b A T 8: 111,011,348 L256Q probably damaging Het
Disp1 G T 1: 183,089,173 A561E probably damaging Het
Donson C A 16: 91,688,592 A41S possibly damaging Het
Gldc T C 19: 30,145,658 E279G probably damaging Het
Gpr160 A T 3: 30,896,714 I312F possibly damaging Het
H2-Eb2 G A 17: 34,344,555 probably benign Het
Igdcc4 A G 9: 65,124,151 Q457R probably benign Het
Irf2bp2 T C 8: 126,593,345 D31G probably damaging Het
Klrb1 T A 6: 128,713,634 K42* probably null Het
Lrrfip1 A T 1: 91,110,399 E446D probably benign Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Maml3 A G 3: 51,689,969 V1098A probably benign Het
Mrgpra4 T C 7: 47,981,119 S245G probably benign Het
Mybbp1a A G 11: 72,451,287 E1283G probably damaging Het
Myh2 A G 11: 67,177,400 S285G possibly damaging Het
Myh7b A G 2: 155,633,399 D1876G probably benign Het
Nr4a2 T C 2: 57,112,379 S21G probably damaging Het
Olfr1049 C A 2: 86,255,322 V124L probably benign Het
Olfr1384 T A 11: 49,513,812 M58K probably damaging Het
Olfr251 T A 9: 38,378,352 M157K probably damaging Het
Olfr843 A G 9: 19,249,087 V104A probably benign Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Pcsk6 T C 7: 66,025,308 S476P probably damaging Het
Pex10 T C 4: 155,067,905 probably null Het
Pgf T C 12: 85,171,787 D63G probably benign Het
Piwil4 A G 9: 14,715,000 S465P probably damaging Het
Plcb1 A C 2: 135,345,090 H759P probably damaging Het
Prodh C T 16: 18,073,640 V480I probably benign Het
Rmnd1 A T 10: 4,410,809 probably benign Het
Senp2 G T 16: 22,046,667 W580L probably damaging Het
Svep1 C T 4: 58,046,601 C3510Y possibly damaging Het
Tanc1 A G 2: 59,839,013 I1274V probably damaging Het
Tep1 T C 14: 50,836,806 E1874G probably damaging Het
Tgfbr2 T C 9: 116,109,941 T298A probably damaging Het
Tlk1 G A 2: 70,725,547 R423C probably damaging Het
Trove2 T C 1: 143,770,786 I74V probably benign Het
Trp53rkb T C 2: 166,795,475 I117T probably damaging Het
Ttll9 A G 2: 153,003,007 T432A probably benign Het
Vit A G 17: 78,586,826 H219R probably benign Het
Zfp112 A G 7: 24,126,143 D512G probably benign Het
Zfyve19 A G 2: 119,210,831 K76R possibly damaging Het
Other mutations in Pmfbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Pmfbp1 APN 8 109537993 missense possibly damaging 0.75
IGL01505:Pmfbp1 APN 8 109513911 missense probably damaging 1.00
IGL01609:Pmfbp1 APN 8 109527716 missense probably benign 0.12
IGL02066:Pmfbp1 APN 8 109541733 missense possibly damaging 0.76
IGL02926:Pmfbp1 APN 8 109520249 missense probably damaging 1.00
IGL03374:Pmfbp1 APN 8 109542414 utr 3 prime probably benign
R0022:Pmfbp1 UTSW 8 109525407 missense probably damaging 1.00
R0022:Pmfbp1 UTSW 8 109525407 missense probably damaging 1.00
R0046:Pmfbp1 UTSW 8 109535985 splice site probably benign
R0068:Pmfbp1 UTSW 8 109542379 splice site probably benign
R0211:Pmfbp1 UTSW 8 109541740 missense probably benign 0.03
R0244:Pmfbp1 UTSW 8 109541673 missense probably damaging 1.00
R0468:Pmfbp1 UTSW 8 109513968 splice site probably null
R0479:Pmfbp1 UTSW 8 109530473 splice site probably benign
R1124:Pmfbp1 UTSW 8 109530483 critical splice acceptor site probably null
R1332:Pmfbp1 UTSW 8 109530266 missense probably damaging 1.00
R1336:Pmfbp1 UTSW 8 109530266 missense probably damaging 1.00
R1621:Pmfbp1 UTSW 8 109499538 missense probably benign 0.04
R1961:Pmfbp1 UTSW 8 109530144 splice site probably benign
R2069:Pmfbp1 UTSW 8 109532103 missense possibly damaging 0.68
R2125:Pmfbp1 UTSW 8 109520273 missense probably damaging 1.00
R2889:Pmfbp1 UTSW 8 109525431 missense probably damaging 0.99
R3034:Pmfbp1 UTSW 8 109520921 critical splice acceptor site probably null
R3956:Pmfbp1 UTSW 8 109530169 missense probably benign 0.25
R4085:Pmfbp1 UTSW 8 109494947 missense possibly damaging 0.92
R4410:Pmfbp1 UTSW 8 109532063 missense probably benign 0.07
R4418:Pmfbp1 UTSW 8 109530633 missense probably benign 0.36
R4888:Pmfbp1 UTSW 8 109532160 missense probably damaging 1.00
R4937:Pmfbp1 UTSW 8 109535866 missense probably benign
R5070:Pmfbp1 UTSW 8 109530155 missense probably damaging 0.99
R5184:Pmfbp1 UTSW 8 109527767 missense possibly damaging 0.92
R5552:Pmfbp1 UTSW 8 109531751 missense probably damaging 0.98
R5609:Pmfbp1 UTSW 8 109525107 missense probably damaging 1.00
R5760:Pmfbp1 UTSW 8 109521023 missense probably damaging 0.99
R5818:Pmfbp1 UTSW 8 109538679 splice site probably null
R6378:Pmfbp1 UTSW 8 109530266 missense probably damaging 0.99
R6496:Pmfbp1 UTSW 8 109532157 missense probably null 0.04
R6550:Pmfbp1 UTSW 8 109520207 missense possibly damaging 0.90
R6565:Pmfbp1 UTSW 8 109525428 nonsense probably null
R6624:Pmfbp1 UTSW 8 109530190 missense possibly damaging 0.92
R6684:Pmfbp1 UTSW 8 109535830 missense probably benign 0.10
R6823:Pmfbp1 UTSW 8 109530307 missense possibly damaging 0.92
R6833:Pmfbp1 UTSW 8 109538675 critical splice donor site probably null
R6940:Pmfbp1 UTSW 8 109525191 missense probably damaging 0.98
R7000:Pmfbp1 UTSW 8 109530589 missense possibly damaging 0.92
R7411:Pmfbp1 UTSW 8 109513871 missense probably damaging 1.00
R7563:Pmfbp1 UTSW 8 109525374 missense possibly damaging 0.83
R7782:Pmfbp1 UTSW 8 109527780 missense probably damaging 0.96
X0065:Pmfbp1 UTSW 8 109535867 missense probably benign 0.25
Z1088:Pmfbp1 UTSW 8 109513944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGTAAAGACTTAGGCCTTG -3'
(R):5'- GAGTCTGCGTCTCACCTGAC -3'

Sequencing Primer
(F):5'- CTGGCTGCTTCAGTGAAAAATAGCC -3'
(R):5'- GACACCTTCAGCTGCTCCCTG -3'
Posted On2015-06-10